Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0414.1   

sjj_B0414.1RNAiJA:B0414.1
PCR_productsjj_B0414.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0414.1 Source_evidenceePCR632WS150 Sequence/Annotation Release
Overlaps_Gene B0414.1 Source_evidenceePCR632WS150 Sequence/Annotation Release
Chunk_score Abs_score569
Max_abs_score569B0414.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58024385803399
Overlaps_transcriptB0414.1 Source_evidenceePCR632WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0414.1962aaagtttccaagcaacacggaatctgctatacatagtctattcactaattcaaattatttctaagctcgtaaaaatattttgtggaactgaatcggctgcatatggtgtgcgtactttcccagaaaatatgtcactgattgaaaaaaattttgatgtcatatatgatgaatgttcatcaactatcgacttaatatacgtggtaattactggttaggttttcaatttaacaacaaataacactgattttagcgtatttatgtggctggagacatattggttatgttcgctgccattatgtatgtaataatgtttatgaagatccggagatggagcaagatgactggagatcaactaaataatcccgagaaatatattttctatcaaacagttctaatagttgttacaaaacttttggctatcaatgttattctcgttatgtgctatcaagacggatacagtgacgattgggtaagtgaaactactgacaaaagactgatgaattgacttctattattccaaattcaggcatttggagcatttgttgtatctgatgttttaactacacctttcgtgattcaaggttcatatcttctatgtaatcgcacaaatgtagacacagttctgtcgattcagttcaaaacgatgaaaacttggaagatgataatttgtggtttaggatccgttgcagaaggtagacagagacggagggaattcaaaatgagaatatatgcagcaaaaaagaaggcaaaggatttgattagaggatcaggcaaagatggtaccatatcgaaaccaggtgcctatataattccagtagctcagaccccataaatcgtgttttatctgagaaataaagtttctaatacaatgattagattgattttcattctacatatattcggagtatcaaactaaatacaagatgtaaactggcaatttagccaggcagtatttcccagaa