Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0464.7   

sjj_B0464.7 RNAi JA:B0464.7
Simmer:B0464.7
PCR_productsjj_B0464.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0464.9 Source_evidenceePCR984WS150 Sequence/Annotation Release
Overlaps_Gene B0464.6 Source_evidenceePCR194WS150 Sequence/Annotation Release
Chunk_score Abs_score173
Specificity_index0.171
Rel_score0.207
Map_statusBottom50_percentile_ePCRIII94656649466847
B0464.9 Source_evidenceePCR984WS150 Sequence/Annotation Release
Chunk_score Abs_score837
Max_abs_score837B0464.9
Specificity_index0.829
Rel_score1
Map_statusBest_ePCRIII94656649466847
Overlaps_transcript B0464.9 Source_evidenceePCR984WS150 Sequence/Annotation Release
B0464.6.3 Source_evidenceePCR194WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0464.71184tcaccatgtccgacgataaattagacactcttccggatcttcaatcggaaacgtcacatgtcacaactcctcacagggtacattaatagtgaaaattaacaagatgatgttttattaaatatcaatttcagcaaaatgatcttcttcgtcaagcggtcactcatggaaggccaccaccagttccgagcacatcaacttctggaaagaaacgagaaatgtctgaactaccgtggtcagatttttttgatgaaaagaaggacgcaaacattgatggagatgttttcaatgtgtacataaagggaaatgaaggtccaattttctatttgcttcacggtggaggttattcaggcctcacatgggcgtgttttgcggtatgttttgttctattctagtgtcagtcattaatggttctgttcagaaagaattggcaactttaatatcatgcagagttgttgcacctgatttaagaggacacggcgacactaaatgttctgatgagcacgatctttcgaaagaaacccaaataaagtgaggtttcgctttgataagttttgtaacttctatcgacatattgtagagatattggagcaatcttcaagaacattttcggcgaagacgattcaccagtatgcattgttggacacagtatgggtggtgcattggccattcatacattgaatgcaaagatgatttcttcaaaagtcgctgcactcattgtcattgatgttgtcgaaggttccgctatggaagcacttggaggaatggttcattttttacattcaaggccttcttcatttccttctatcgaaaaagccattcactggtgcctttcttcgggtacagcgaggaatcccacagctgcacgggtctcaatgccgtctcaaattagagaagtatcggaacacgagtacacttggcgaattgatttaacaacaacagaacagtactggaaaggatggtttgaaggattatccaaagaatttttgggatgttccgttccgaagatgcttgttctagcgggcgttgatcggctggacagggatctcacaattggtcaaatgcagggaaagtttcagacttgtgtgttaccaaaagttggacattgtgttcaggtaaatgttatactcaattaataatttatataaattgtcttgcaggaagatagcccacaaaatcttgcagat