Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0491.5   

sjj_B0491.5 RNAi (2)
PCR_productsjj_B0491.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0491.5 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1134376711345308
Overlaps_transcript B0491.5.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
B0491.5.2 Source_evidenceePCR858WS150 Sequence/Annotation Release
B0491.5.3 Source_evidenceePCR849WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0491.51542aaaatccaatcagtatcgtgtggtcggaacatcggcatttccaagttgcatcttctgccaaagaagtggtcctccccagattccggcagattgtggatgagcagtcattccttggagtccagtctccgagtgtcgttgatactgccagaatgctccgaggatggcggtgaagatggcggcagtggttccaagggcaacgttgctctctggaaaaatagtggttttgaaacgaaaaattaaatttttcaggaattaaccaggacaatcagattttgattttgtgtctagattttttatttgttaaaaaataaaaatgtacaagttttgccagatttacagagaattttgttaaattttaaaaataaatattcatattttaagccgaatttttattattttcagactaatttttattaaaatatttcgaacaaaatattttttcggacagaatcagaactaattgattatgagatacaatgataatgtggctgctaccatgaaagataattttttgaattgatttttttctattttggaaaattacgaaaatatattagtttctgttttaaattttttccatgtgattttcttcgaatttaacagaaaatctgatgaaaacacataagaaatcatttaaatagaattaaaatttttttctacgctctgaaaaccacgttttttgatcatttcgccaaattggcttacaatttttaacaaaacatactcatggtagccacggttgatccaacagcaacactagcgaaccaatgattatggacatcatccttatgacggatcgatgaggctgctgaaagactgaagccccaggcgaatgcaacggccaatgggaatggagcgagttggaggtatctcttcatataggttcttggcgagaattcggataccgagactgtattgagtgcacggatttccagcatagtgtatggagccactgaaattatgttttatgattatcgtgaacattttttaaatcttaatctagtcttacacaaaattccagcatacttggcggcggcaagtcctttccagaaagatccctcattgagtggactgtcgaagaaacggggtccggcaggataccaagagtttggcaacacggcgtttctgcctaactcgtcctttggagctggaaataaaaaagttttgtagcaggatacttataataaaattttaattattcctcacttagcatattatcgctcaaggttggactaacggatagtcctggatgctctttgctgattccaaacttttcagcgatagccttaaactggtgggatccttcgtaaactttgttctggaattcggacagctctcctggctgatctccttttttggtgagatttttggtcttcttggaatcgagtccgaaaggtccggccagggattctccgtcttttacctgaaaacgcaaaaaattagcgaatatcactcaaaataaattaactgtacctttggatcataccaatctggatcttcctcacggaaacgagcacgataaagacgaagttttccagaacg