Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0511.2   

sjj_B0511.2RNAiJA:B0511.2
PCR_productsjj_B0511.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0511.2 Source_evidenceePCR833WS150 Sequence/Annotation Release
Overlaps_Gene B0511.2 Source_evidenceePCR833WS150 Sequence/Annotation Release
Chunk_score Abs_score707
Max_abs_score707B0511.2
Specificity_index0.545
Rel_score1
Map_statusUnique_ePCRI1065131710652512
C01G12.12 Chunk_score Abs_score590
Specificity_index0.455
Rel_score0.835
Overlaps_transcriptB0511.2 Source_evidenceePCR833WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0511.21196tccatgtcccgactgaaaatatatattccacggggaggcaaagctaacgtggccgcgagagctgcgccggctaggccaccgcctcctatggttaagaattttgatcgaataaacatttttaatttgacttatatgcttatttttcttcgttttttcttattttttcttgtttttttttgttactacgtggaataagcataatgttttcagctaatctacgcaaaccgcttcgaaattcgatggattaaaccggacaaaggtaagaaacgtcgaaaagtaagttattattcaaaatatctcgaaaaattatggtacaatatttctgaaaacctactcaaatatggaaaaatatatgctgattccggattgaaaagtcttgaacctcaatctcgcgtatttcttattgagtttctcgattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaagaattatggtacaatatttctgaaaacccactcaaatatggaaaaatatatgctgattctgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttagtttctcaattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaaaaattatggtacaatatttctgaaaacccactcaaatatggaaaaatatatgctgattctgaattaaaaagtcttgaacctcaatctcgcgtatttcatatttagtttctcaattttagtgaaaaattcgagaaattcagtgcaatttcgaattaaaaattaaatttttccaaaaattatggtacaatatttctgaaaacccactcaaatatagaaaaatatatgctgattctgaattagtaacatttgaaactcaatctcacgtatttcataatttttttttcgattttaatgaaaaatatattcagtgcaattttcgattttttttcaaaatattttctcttaatgtttttataatttccagatattacgttgtcgctgcattagaagatttcaagacaaaattcgaaatatatgcgaacaagaagaagctgttcgaagtattaataaggaaggctaagcagcaataagtgctcttacaagggctcaagtgccgcagaagaagccaaagaaagtaggactgcaaggtcaactgctcaatcagcca