Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0511.4   

sjj_B0511.4RNAiJA:B0511.4
PCR_productsjj_B0511.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0511.4 Source_evidenceePCR901WS150 Sequence/Annotation Release
Overlaps_Gene B0511.4 Source_evidenceePCR901WS150 Sequence/Annotation Release
Chunk_score Abs_score817
Max_abs_score817B0511.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1064447910645519
Overlaps_transcriptB0511.4 Source_evidenceePCR901WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0511.41041aaacgaaagcttttgctccaacactcgagaaggtctggaagctcaaatttgagaaagttctcggtaatcatttggaaattaattccaatttataattcattaatttacaggtagtggctcctattcccgtgtggcacgcgcaactttcggagagaaaaagctcgaagttgcagcgaaaatcatcaacattacgccaactcgtgaaaaagaggactacatcaaaaagtttttgccacgtgaaaaagagattgtcaagctcttgaaacacgataatatttgtcgtttgtacgagatgatttcatttcaagatcacatcatcttcgtcaatgagtactgtgctggaggagatttgctccgtaaaatgaaggatatcgtggcaatgaaagaggaagatgcaaagttcacatttcgtcaacttattgcagcacttactgtaagttttatatcagaaaactgtttttcttaaatttataaattcagcatctgcaatcctataacattgtgcatcgggatctcaaatgcgaaaatatctttatggataaacatggaaatgtgaagctcggcgacttcggattctcgagaattctgaaaccgggtgaaaaatctggaacattctgtggatcgcgagcatatgtggctccagaaatttttcgtggcagagaatattctggaaatgcagttgacgtatggagtactggggtcattctctacataatgctggctggatcaatgccatttgatgatcgtgacccaaggaaaatgatcgagagacagttggcacataaaattaagtagtttttttttaaaagacaactcaagttaaatttctcatttcagattcccgaaaagttgcacatcatcggtcttttcgaaggctctggtccttgagattctccagccacatgcaccgaaccgtccgacctacaaagcaatttgtgaatctgaatggctccgtactcaaccgtactacatgaaacccaatgagccaccaaaagtattggcaactcgaattgtgtcacctgcaactccgattgttcctgt