Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0511.7   

sjj_B0511.7 RNAi JA:B0511.7
PF:GL1_5A8
PCR_productsjj_B0511.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0511.7 Source_evidenceePCR603WS150 Sequence/Annotation Release
Overlaps_Gene B0511.7 Source_evidenceePCR603WS150 Sequence/Annotation Release
Chunk_score Abs_score540
Max_abs_score540B0511.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1063188010632876
Overlaps_transcriptB0511.7 Source_evidenceePCR603WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0511.7997gagatctggtgcagcattcaaagccattggtccaaaagttgaagaaagcggtgcagacatcaattcacgacccgggcggacaatctttctcggtggttccgatctttttggatctcctggtcgtttattcggatttgttgatataattgcagttgtcacaagatttcggaatcgtccaactgatggatcaacatcttccggattgataacttcttcttcttcaaggaaagcaacatttccacgtggtcgtttctttcgtcgagcttcttcgacagatatcggaagttgtggaatacgacgattttgagcagtgttgtaggaagtttggtgctgaaaaaaagtaatctgtgatttcaatttttaagttaaagaaggctctgggtattttgaacatataagctcaaaatgtaaaaataaactaattttataataaaacttctcaaaagctgttcaaaaaacttgaaattagccaatttcagccaaaaatcttgaattttacctaaagttccgtgtcggaaaaatgataatgaaataaacgttaatttccaacagatgtgactccgaaaagtttggaaattttgggattttggctaaaatagttaaatttttgagaatttcattagcgctttttgagtctatacatataaaatatccttatttataaaaatcctacatctaattgctcgtcagaagcagcaacagttggatcgtcttccacgtggtgctcagttttcaaacgaactgaatattttcttgtagacgcgccgagatgaaattgtgttcctggatccataaatacaacctcaagtggacgaagtctcacgtttccaaggaatgtaccgtgacctgaaaattcgattatttgaaaatttgcattaaattcaacgttatacatactgctatccatatctataagtgcgaatcgttgcaatagaccgtgataaaggagaagtgcgtgtactcgggagcaagaagcatgctcaacagcgaaatcaac