Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01A2.2   

sjj_C01A2.2RNAiJA:C01A2.2
PCR_productsjj_C01A2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01A2.2 Source_evidenceePCR663WS150 Sequence/Annotation Release
Overlaps_Gene C01A2.2 Source_evidenceePCR663WS150 Sequence/Annotation Release
Chunk_score Abs_score537
Max_abs_score537C01A2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1339682013399076
Overlaps_transcriptC01A2.2 Source_evidenceePCR663WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01A2.22257tcgcactagattttcaggacattttcgaaaaatgtaaaatcaaaaattcggtcataaatatgctagattataaaatacagaaaaaatgaacagagtctcgttatttgaagtaccaaaagaggaaatattgaaaaatcggaagtttcaaaattcaaatttcattacatttttcattataaatttcatattaaattttaaaaaaaaacgtgcttccatgtctgcccatctctgcctgcctacccatacgcgcctgcaacatgccttctgatgcctacgcgcctgccagtttggccaatcaataatatatgtgtgaactgttcaaaaatcacttttataataaaacatattctcacataaaccaatatttttctcttctttttctcctctttatcaatttttactccttatcatctcaacagtttcccctatttccagatgtcctcgtggcgctcaaaaatacctaccgtaacccaagtacaacattttctacgcgggattgtgtatgagcaggaagtggattattcgaggtttgagacaaagtgagtcgttttttaattcatttaatcaggcagcctctagttacccttcaggcaagtaggtaggtaggtaggtaggcgcctatactgaatttctaggttgaatgtccccacctgaccttaacttgcagactggatggatcagaagtgataaccttccgtgagaatgacaaagccttccgattatttgggacaaacgttcatgtgaaggtaggtgagacagagtgcagagaagctagacactatgtctgtctgtgccctctctctttctcttgtactctctaatatcatttaatcttctaggtcggatcctacatcgcgtgtgccatcggattcgccgtcaccatcgcattctgcgtctcttactctctattccactctcgtggacagggacggaatccgtttattgatcatttggagatcagtaagtgtgctctattgataattattttaaaaacaattttgatttccagttgatttgatcttcgccttccttgtgggtctaccatgccatattttgctattttacgggcttcagaagagcaaaaaggtcttctttaggtaagttgtgagagagagtgagaaagcgcagagaagcgagagtgtctggtttctctgcgccctctcccctctccaacagtttccattatcaatttacagcccgttccttgtgttttacatgacaaacttcattttgaactgcattttcacaattttgacgcttggagcatttgccatggatgttcatcgacgagttttcgggaatattcgatttgatttgggatggactgcttttcaggtaaaaaatgagagattttttattgaattcccgcgcgcaaccaaggagagcgaccaatcagcgatgttgaccacgccccctgcgcatcgctgattggccggatcttgtttgtgcgcgaatccaagcgtttctcagttgaaacgtgcatattttactgatttttaaaaaattaatttcagatctgcttcactgccgcccaggggcttgcgatctacgttgtgatgcgtgggcgtaaatacgtggctgccaagagcttctggatgaataagtataatcagagaacgggtcctgatgatatcattgatgcttaatttatatcgaatatgaaaacttatgaaaaagaataaaaatatgatttttaaaaaaattttgttctaatttcaaaaaataacttgacaacattttgaagttcaatttttttcaaaaacatttaatttttaaaataaatttgtgtacgattaatacattaatacattaatactgccaaaaattatggcgagaaatttttaaaaaaatctgaaaataggcgccaaattcaaatctaattttttctaaacattttggtcctaaattcgaattaaatttttttcaaatttcctacttttaaaactacttttcaaaacttccaagctcaacatacatatccagagacggaaagaaatcagacaccctaacttctctgcgcttccacattttaggctatctgcaaattctaacaaattaggggcacttttgagacatggaaaacttacggatggattttgaaatttgagcataatcccacggaggcgttgactagagaaaaaggggtgtctgtgaggggagaatgggtgttaattagcagaaagagaaaaagtactcttatttcttttatttttccgttggaattgacgaggaggttacccgaaagttcagtttcaaa