Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01A2.3   

sjj_C01A2.3 RNAi JA:C01A2.3
Simmer:C01A2.3:Screen_A
Simmer:C01A2.3:Screen_B
PCR_productsjj_C01A2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01A2.3 Source_evidenceePCR720WS150 Sequence/Annotation Release
Overlaps_Gene C01A2.3 Source_evidenceePCR720WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678C01A2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1338883213390314
Overlaps_transcriptC01A2.3 Source_evidenceePCR720WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01A2.31483tcagagttccaacacttcatcctaatacatagaaaattttaaaaaaatcggttcaaaattatcaatttctaattttccaggcattcacgtgcaccttgacattccctggtgggttacaatcgttgcagctacagtaacccttcgtgctcttttaatcggtgtccccgtaatgtctcagaagcttgtggcaaaacaatcaatgtatcgaaaggaaatgaacgaattccgtgatcgaattgatgaagctcgtaaagaaaataatcaacttcttcaacaacagattcttctggaacaacgagattttcttcgatcaaaagatattcgattgggtcgtcaatttatggttatggctgcaaatggagctgtatttgctactcaattctttgcaattaaaaagatggtagttgtcaattatcctggattatctactggtggaacattatggtttactgatttaacagcaactgatccatattatgcacttccattcatctctgcagctactatggctttggtgacaaaagttggaattgaaatgggtacatcagctgatcaaatgccaccaattatgcgtgcatttatgacttatggtcttcctgttgttatttttggagtttcttcacaatttgctacggtacgagagcccaaaagttgtgatttgaatataaaaattccattaaaaagtgatagaatttagaaaatttgaagaaaaaaaaaattacgatgaaatccgtaaaaatcaggagtgggcagtgtttattccggcaatttaccgattttcctgaaattttcaactccggcaatgtgccgattttccggcaaatcagcaaaaaataattgtacattttgaaattttgaaatttcagataaaataaaattccaaatttaaaataatttaagagcaaaatatgaaaaatctttccaaacaaatcaccttttttgttttaaaattgtattttccttaacaataaaaattttgttttttcagggtctatgcgtatattggacagcttccaacgctgtttcgttgatctacgcggccgcattcaaagttgacgcgattcgaaaaatatttggaattccaccagttgtaccacttccaccgagtgccgtccaaaagaatgccatctcacaagtcttgaaatcttataaaggtagtttaatcgaattaaatgaaaaatatacgaaaattttgaaaaaataaacggaaaaataacttttattggaaaaaagtaaaaaagtactataatattgaaaaaaaaaattctgtaattcgaaaaaagtaccatagtttgttttttatttgaaaaaaattaaaattttggaacaaaaatattccaaaaatatatattttttaaaaattgtattaaaaaaatactaataaattaaattaaaaatattttatctgaaaatttaaattttgaaattaaaatcctatgaaaaaaattgtatgcttctaaactatccacgaaatttcccaatt