Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01F4.2   

sjj_C01F4.2 RNAi JA:C01F4.2
Simmer:C01F4.2:Screen_A
Simmer:C01F4.2:Screen_B
PCR_productsjj_C01F4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C01F4.2a Source_evidenceePCR445WS150 Sequence/Annotation Release
C01F4.2b Source_evidenceePCR445WS150 Sequence/Annotation Release
Overlaps_Gene C01F4.2 Source_evidenceePCR445WS150 Sequence/Annotation Release
Chunk_score Abs_score362
Max_abs_score362C01F4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI48538544856312
Overlaps_transcript C01F4.2b Source_evidenceePCR445WS150 Sequence/Annotation Release
C01F4.2a Source_evidenceePCR445WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01F4.22459caggtgtgacacagacacttctctactataacttaccttttggtttgcccaagttgacaccgggaagcatttttgtgagacgttgagcggcgaggagttgaagagcagatcgttcgatttctgataggttttctagtcgagcaccacgtaacaccacttcggcaccatctaccgatcgccatgtcatactgtcctgaaaatttaaatttgaaaaaaaagcggattactaaaataacaagtttttgttttaattataataatttcaaaatactttttttttcaaaaatttgaaaaagacatcaaatcgtgatagaaagctgccgtttgccaagaacattgtgtcggtcaataattttcagcttgttttcagaaacgttccaagtttttcaaagcatttaaactttagcgagttttcaaaagtaatatttcagtagtgttttttcgtgaatcccacatcgtgatttcactatgattttttgaaaaatcgaagaataaatagccagtcccgacaacttaatttccttgactcaccaatgatttccatgcagaatctgttgatgaagatgttgaacttgcatgtgaatatgcatattttggtttcaacttccatagaagcttctgcgatgagtatttccatccctcggaatgcgaactgaaatttttgactttacaatcatcaagttttcagctgtaatatttaattggttgtaggggaactattcagctgtttgaaagattgaaaatatttgaatgactaattcaataattttattttatgggcaattcttacttacaattctcacttgttaggtgttcaattaaaacattctacgtcaactccattcccggttttagaagcttctaaaatttacccactacttcgaagttaataactattaaaatgaagtcggtatctacataccaggtcgagctctgtaaacggtaaattaagcaaaattaggcaaagttgccgcacgcccctgctacagactcattaaaatacacttgaagcacgtcaaatatcgcgtcaaagttcagggaatccacgaaatttgcatttaatccatttctccttaactctcttccctagaactaaaaaagccatgtcaacattgttcaaatatgctcaataactcccaattgttttcaggtttttttgagattggtgaaaacaagtaaaaataatcgagaagggaaaataatttgaattcccgcgggatctcatttctctctttctcgcttttgtttttcatatcaattccagaacatgataacgtgggcgagatgaagagtgagagcagacaaaaaatatggcttcgattacgtagaagattttatgaacaaaaatgaatcaaatgattcgcggaaataattgagagaacaaagagaggactttataaggaaagtatgagatatgcgaagttttcttaaaagtcttgaacatcggtgcagtgtgcctgcctgaatgcctggtgcctactcgtaggcatgaagtcctgctgcatttataggtgaacaaattggcaatttaccaaaactttggcagaaaatttttaacaataaaaaagttaaactttaaggtgtttttgtgagatttttaccgcaattcgttctagtcatagtcaatcatatcaatacaaaaaaacagggataaaagcagagaagaacacgaaaattcgattgggaaactcgaaaacccagagaattgtctattttcaagaattttttgggtttctccgtgtatattttactaatataactacaactttaaataatttaattaaacgctctcaaatttttccactgaaatacttgatttaactgcccgtttttgttgctcagaatttcgagagtttccataactattttgcactttcaaaaatttccgagtagctctagaaccgagcttccaaaatatttcaaatgaatctgattcttcctccccttgaactttgactcactttaatcatcaactctaaaaaacaaaaacaaacctgctcgctgaaagcggaacattcggagaaacaggtgccgtcatcgagtagttgtgatggtgatgagacgacgaatcggcgacgccgtgcgcgctcgttccggcgatgtctagcgtgtcatgcgaatcgttgaaatccgacgaatctcgtgaatcgcgaagacggccctggaaaaatgtgaagataatttgaattttggttgaagtttcggaactttttgccaaatacttttaaagataattacaattaaatgagaactaggcatttactacaaataaattaaaacaatttttaaaacatatttctgtagaataaagtgggaaaatctggatttttgagatttggaagactagaaaacaaaacaaaggaatacttgatatttttcaacgggtaaaaaacgtaaagacatagtaaagatcattgacattcaatttcaatttgtagaggtggatcttgaggcttaac