Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G5.5   

sjj_C01G5.5 RNAi JA:C01G5.5
PF:GL1_5A10
PCR_productsjj_C01G5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G5.5 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene C01G5.5 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score615
Max_abs_score615C01G5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV65247596526372
Overlaps_transcriptC01G5.5 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01G5.51614ctgtcgacgaagcactcaaagttggataccgtagtttcgacacagcgaagtactatgaaaatgaaaaggatttgggtttagctcttaaagtatgaattaacgaaataaaacgcaaacatgcttttttaggaaaaaaagaatctgatagaaaatatatcattacccagactcgcgttttgtgccaaacatacgttacgcggtctcggcgcggcaaatgtttgctaattgcgaaaaggtgtgcgcctttagagagtactgtaattccattctcttcacgttgcaccatgaattataattgattttcgtagtttttcttaattaaagacacaaccatttttatcattcgtgtgaaaatcaataaaaattctgcagaaacgaaagcttaaaattttttacagtactctttaatggagcacatctgtttgtatttaacaaaaattgtcgtttcgagaccgcgtacagtagttttagcggaaattttgtcatctgggttatacgctagatcgaaaatatttttttgacaaacaactttcagactcttctcccacgtcacaatatttgttctgaggatatctacttgacatccaaagtgtttccgtattcaagtaaaaatgctgctgagctaatcagaaaagatgtcaatgaatcactggaattgttagatagaaagtaagaagaaatatcaaaatctatttaaatttcctatgaaaatttcagatatttggatttggttcttgtacactaccctcgtcctcttgacactgaagatcttaatgaaaataacaaaatgtatcgtaaagatacgtggattgcactggagaagttgcatggtattattacaatctttattgaaaaattggaaaaattatcaattatccgtttccagccgagggaaaaattcgctcaatcggagtctcaaactacgaaccacatcacattgaagagatgagaagttacatcacaattgaaccacaagtcaatcaaatcgaatatcatcctcacttccagcgaaaagtcctccgcgcctactgtaataaaaacgaaattcttttccaagtaaatattcccagtaaaaaacttttttaatcaacttttttaggctttctctcctctcgggcgtgggaacaagactctactgggtgattcaacgatggagcgcattgctttgtgtcataagacaacagttgctgtaagtgaagtgatgacgaatgatcataattctagttttattacagaatgtcatcttggcatggattatgaaaggaaaatatggtgtcgttgccaagtcggtcactccatcgagagtcgcagaaaattacacggtgaattttgaaaaattgaaagtaaaaaaaaactaggaaaaaatattcagaaaataaaccataaaatgtaatttttatgaaatgttgcttatgttgatgaaaaattcttctgaaaggaggaaaaacgaccaaattttaaagctatttttttaaaaaatcaggtttttttgttgaaatatcggaaaaacgaaaatgaaaaccttcaattttcagtctctttccttggaactgtctgatgatgagttcgaaaagattaacggattgaatctggaaacaccatacgtcgaggacc