Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G8.2   

sjj_C01G8.2 RNAi JA:C01G8.2
PF:GL1_5A12
PCR_productsjj_C01G8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G8.2 Source_evidenceePCR764WS150 Sequence/Annotation Release
Overlaps_Gene C01G8.2 Source_evidenceePCR773WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647C01G8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI52772245278710
Overlaps_transcriptC01G8.2 Source_evidenceePCR773WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01G8.21487acatcaacgctattttcccgatcttcccgtattcctaaaagtccttcttcttcctcaacttcttctcttctcatatcatctgccggaatgaaatctccggtgactagccacgtggatggttgaagaaagtgtgctcgttggacactgtgtggaattttgagaatcgaccaataagaaaccgaaaagagtgccggaagtgtgagcattatgaacattgtgtgttttggtgaaattgcgagaagtttcgaatcggtgagcaaagcatatgcagatgctccgataagacctgctccgccagttccagaagaccacgacgcgacgacagttctaaaaaaaatgtaatttttatccttctgctatataattttgtgattttatgaggaatgagccgcacaaaacattaagcgtcttgaaacagtacagtaaccaggacagatttttaaaacagctatttattttttgttatttttattttaaaacggagtgttttcaaagtttttaattttatttttcgaggccaaaaaaccgaaaaaacctattaaactttaaatgtttttgtgttttgctttttttttgttgcaaacatccgggaagcggctactgtactgcttaaagacgcagcccattttgcactgtttcaattttaaaatttttcgttcgtggtgagagactcacgatgggtaatttgaactcaatgccagatatgaaatctctccgagaccactaccgaaacttgccagcacaactcctgaaaatctaattttccccagtattactgtaataaacaaaccgaaaagtgccaaagctgttgaatcactaattccaacaatcagaaaacttgatgcttgaagtaatacgacgattgagtgacgaattctttaagaaatgttttttaatagaagataaaacgttacaaacccaaacggtacccgatgaatgaacatgggagctgtgattttgatcaaaagtgctggaattatgtcagcaagaagaacagatccagttgacatcatttgacattctcgtgttgttacatgttcctgttaaaatgggtgtttgtagtgtgagacttatgggttttcatgcctgcctgcctacctgcctaccaacttttaatttattgtataaaattgcaactccgattttttacaaaaattattccaaagttcatggcaattatttaaaaaatctctaaaattatgtttgctaaaatattcgtttgtattttgccagtaggcacaaggcaggcaggcgtctccatatcaaacctactcgacacggtttttcgatatgttttgcatctttttcgagaatatctttggcagcactgagcattactacgtaggcgaagttattgcataatccgagaagcctgaagttatattttcttccagattcagaatatttattcctaaaaccaaccaaaatgccaccgaattcctgggtggccgccttcctcctccgcttgccacatccattctggaatt