Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G8.4   

sjj_C01G8.4RNAiJA:C01G8.4
PCR_productsjj_C01G8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G8.4 Source_evidenceePCR504WS150 Sequence/Annotation Release
Overlaps_Gene C01G8.4 Source_evidenceePCR504WS150 Sequence/Annotation Release
Chunk_score Abs_score399
Max_abs_score399C01G8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI52823075283466
Overlaps_transcriptC01G8.4 Source_evidenceePCR504WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01G8.41160gcttttgctccattcgtttctctttgagactacgaatatgatctgcgtcttggagagctcggaaccacctgaaaatacaatttcgtggaattcaatttaattttaatttcaatgctgcctgatttgtttttcaaaccaactttcaaaatgatcaaatcattttgaaacgtatgaaaaaaaaattgtaatgtaaaatttgggtggctgagaggaaagaaacgaggaaaatttttaaaaaaagcgaaaaattcgaatacagtagttttgaaagactttgaaagaaaaactcctttcgtggcgagaccgtattttgtagcgaaaaatctcataatttcgaaacaccttccgtaccgatattcttctcgaatctcattttcatttctttgggttttcgtcttccaaatctcatcaacgtcagcttttaatattcttccaatttcagcaacctgaaaatggtatcgtttgtaaatgaaatcttaaaattctaacctccgagctttcaaagttagcatttcggaactctttttgccgcaaaaagcattttgcaatctcatcttcatcgattaatttgtctagttgcttttgattataagccagaagatatctgcaattttttaaaactctgacaataatttttcgatttacggagctcgtgaactccccgaggagaagcacacatgtttttgactgaaactcttgaatttactgttaaaaaactccatataatgttatctctaatttttttttgccaaaaattgtagactgctctgcaaaattatcacttttccgcggggagtacacgagctcagaatggccgtgttatacgagaagcttgtttaaaaacgcatgcagctttcgtgaaattgcaattttcaataaaacatacaaatatcctccattatatccagcaacaagtactaaaccaatggcagtccatttaacaattgatttcataaattctcttgaagatttatctcgttcttcacgactcgaccgggagttatccggattctgactccaatacgtggaccagtctctgagaatatttgaaattcagaaagaatatttatattttattacgaaccgactaaaatcatattgtggagctgtattcggatattgatatcgttgtcctccattcggatatcttccaccaccac