Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G8.5   

sjj_C01G8.5 RNAi JA:C01G8.5
Simmer:C01G8.5:Screen_A
Simmer:C01G8.5:Screen_B
PCR_productsjj_C01G8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G8.5b Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene C01G8.5 Source_evidenceePCR792WS150 Sequence/Annotation Release
Chunk_score Abs_score708
Max_abs_score708C01G8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI52852315286720
Overlaps_transcript (3)
WB_DNA_textsjj_C01G8.51490cagaacgtcgtagtcagtgacagcgttctgatctttaacactgtcaagctcgcgagtcaacatatccagcttattcttgatctgaatgttcttctcggctgctgtgacacgctccaactcgtgttgtggcacattctgatcagcgtcatttgtgagttctggaagataaaatttgaagatgatattttttctcataatctctcccaattattttaaataaataaaaaaggcataccagttgctccattatcttcatcatcagtggcagtctcatcgtgagcgtgtccattggaaacgtgatgactgtttgagtagtgttgagtgtgttgttgcgagtgaatctgaatttaagaaaaaataattttgaaataaaataaatccagagttacaatcagggattccgttttttttggttttttcggacaagaaaacatttaaaaaaatgtttatcaaaaattttatgttttagttggtatgacgaaaaatgaacatttttgtttttttttgttggttttttggagaaattttaaacaaaatttgtttgttttttggccgaaatttttgttgcaacatcactgcgtacaattaaaaaatctcgcttttaaagatcggattttttattctttcacaattttttttagttttttctttttgtatctcttttattgttgcaaattttttttttaaattaagcttttttgttacagtaatcaactaatttcaggaattactgcatactttttttcattttaaaattttaaaacagtaatttcagactgaaaattactgctcgataattgttaatacggtatttaaaataatttttttaaagagaattttttgtttctattttagtttcaaaaataaaaaatacctgtgtctgaagttgtcttgtaacagtagtctgtctctcgacttcttctctcatcgaaaaaacttcacgttcacgagcatcaacttggtctctcaaatgacgtctctcaccatcactcattgctttttcggattgaagttgagcagtgagctcacgaagttcgtattccttctgttccaatgcttgtttagccaattgcaattgcttgagttgagcctccaatgagtgaattgtattgtgtgcttcagccaattcaagacgagctctctccatatcttcctgcatttgagccatacgcttttcggcgtcacgttgacgctgttcggcttcttcgcgagcagacatctcctgtacgatcaaaacagatttgagtgaaagtttttttagaaattatttgtaaaaacatgtttcaaaaatttccgcaacttactctggtgagcttctcctgctcggcaatcttaagagcacgatcctctctggcttgttgcttcatttgttgaacttcaatggtatctggctttcttctacgcatgtaaagctcgtgatttcccatacacaaagcaagaatacgtttgttgatacggagtcgtggagcgtagaagacaaagtcctgaaa