Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G8.6   

sjj_C01G8.6RNAiJA:C01G8.6
PCR_productsjj_C01G8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G8.6 Source_evidenceePCR878WS150 Sequence/Annotation Release
Overlaps_Gene C01G8.6 Source_evidenceePCR878WS150 Sequence/Annotation Release
Chunk_score Abs_score752
Max_abs_score752C01G8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI52991625300290
Overlaps_transcriptC01G8.6 Source_evidenceePCR878WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01G8.61129cagcttagcaacagccactggtggtggtggttgagaaggatttggagagtaagaagcaacgctgaaaagccattatttttacttagatctttaaaaactttcaaaacctcggagaagctgtaactgtggatgcatatgatccgttggatgaattgcagcggcttggtggaaaagggtggaacagctgtggagagttgttgtaaacctgccgatttgccaacgacgggatacgcgatttggagccgctggatggagcagacctacaataaacagtaaattattatttatttttaagtgatatttgattattacccctggacagatgtagctctcgtattaagttgaggctttgaagcaacatgtgtcgagtttggagttcggcgtgaagcagaagttatactgaaagtaggttacgacatgattcggttcaatatttaaatttaaaagtacccatgatcagtagtggttccattgttggaaagagttttcttggttgaactttgcgagggagccacactttgtggctttttcgcagctctccagttgacgacttcagtccagccgccgtatctttccttgttcacctgttcgtaggacttcattctcacttctcgtttctcttccatcttctccattggcttactctccttcagcccagacgcagaagtgacagtttcttgagaagaggttgtcttgatcgacatttcagacacttcggagacacatgacgcgaatgaagcatcggaattactattagtatcgtcgtcgcagacaagtggagtcgagcagcgcagattgagatcttcaaagtcggaaattgaactgaatgtgacggatgactctgtagaaatcgacggtgcgcgtcttctaagtccagctttcagcatttcggactctttagttgtatcgagtgattcacaaggagtcacactggaagaaatgaatgataataatatatattcaactttattaaatatttacctctcagaattcacagaagaatccgtagcatttgtcttgtgggagccgtcgtagataacactggaagcttagaaattatttgcgagtgatttgttcaatctgagtgctcacttaatctttccgcctccatcggtggaaatcgtgaaag