Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01H6.4   

sjj_C01H6.4RNAiJA:C01H6.4
PCR_productsjj_C01H6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01H6.4 Source_evidenceePCR836WS150 Sequence/Annotation Release
Overlaps_Gene C01H6.4 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score731
Max_abs_score731C01H6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI72110947212244
Overlaps_transcriptC01H6.4 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01H6.41151agaagccatgttgttccaggatgaaccatttcgagatgaactcccatctttcatgagccacgagcatgtacttgagtatttgaatgagttttctaaagattttccaattcaattctcatccaccgtaaacgaagtaaagcgtgaaaatgatttgtggaaggtgaataataaaactacaattaaattcttcatagaattatgagttttcaggtgttaatcgaatcaaactccgaaactatcactcgtttttacgatgtcgttttcgtgtgcaatggacatttctttgaaccattaaatccatatcagaactcatatttcaaaggaaaacttattcatagtcatgactatagaagagcagaacattatactggaaagaatgtggtcattgtgggtgcaggaccatctggaattgacatcacactacaaattgctcaaactgcaaatcatgtaaatctcgaaaactttgaaaattctgaagtttttctaaaaatacagacttcaatttttaaaccccataataactgtttgcaggtaacactaataagcaaaaaggcgacatatccggtgcttccagaatcagttcaacaaatggcaaccaacgtaaaaagcgtggatgaacatggcgtagttactgatgaaggagatcatgttcctgctgatgtcataattgtttgcaccggatatgttttcaaggtaaaaatgtttaaaccggcgtaagaaaatagttaacctggtgtgcattatgaaaatatttcagataatcattagaaattttataaattgttctctttttttctgggagaactcgtgatactttcagtttccatttctggactcttcactaattcaattgaaatataatgatcgtatggtatctccactttatgaacatctttgccatgttgattatccaacaacactattcttcattggtaagtaaattgggaaatcgtatcttttcattcatagttcacatgttattgcaggccttcctctcggaacaattacctttccgttgttcgaagtgcaagttaaatacgcgctctcactgatcgccggaaagggaaaactgccgtcggatgatgttgagattcggaattttgaagatgcacgtcttcaaggtcttctgaatcccgcatcatttcatgtta