Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C03C11.1   

sjj_C03C11.1RNAiJA:C03C11.1
PCR_productsjj_C03C11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC03C11.1 Source_evidenceePCR600WS150 Sequence/Annotation Release
Overlaps_Gene C03C11.1 Source_evidenceePCR604WS150 Sequence/Annotation Release
Chunk_score Abs_score541
Max_abs_score541C03C11.1
Specificity_index0.831
Rel_score1
Map_statusUnique_ePCRI1001460110015536
C01G6.2 Chunk_score Abs_score110
Specificity_index0.169
Rel_score0.203
Overlaps_transcriptC03C11.1 Source_evidenceePCR604WS150 Sequence/Annotation Release
WB_DNA_textsjj_C03C11.1936gattcgcatgtaggcataaagaccttcagagactcatgatcctcaggagtctggtaaaaatgtccggcttgcttcagattgctctttatctggaaatacgcaactaatttgttttcagagagaaacatggcagaaaactttgacacacttctacaacttgctcatcttggttacagtacgcttgcacccattgctcttgctggatacgtcattgcacaatgtggaggaaagaagaaggctggtggatcatcgaatggtggaggtggagctaagactggaggtggtggtgcaactggtgatgatggaaaaagtgataagaaagacaagtcatccaatgatccaaaaccagagggaggtccaaaggctccaagtgataagaatgctgtcgcaggaacacacgatccaaattatcaaactcttgctggagtcgatggaaatgtattccaagagaaaggaaaagctcctgctgctgctggtggtgcttcccctacggctggtgctccaaagcctggaggtcctggaatggctggtgagtttcattggatattcagatctagctacgtactaaaaatcgaatttcagccacccatgatcccaattaccaaacacttgctggaattggaaacgattgtttcgacaagaaagacggtgcaaaaccagctgctggtggtgcttctccaggtgctccaaaagccggtggtcctggaatggctggtttgttttttagttcacagattcttgttataatctaacttttagctactcatgatccgaactatcagacactggctggaattggaaacgattgcttccagaagaagtgaggtcaactcgagcaaactatcctcaaaatcttgtcttcaaaataaaatttttcagttgaatttatttatcattgtgttcgtacttggtattttccagatttttctgaatcga