Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C03D6.8   

sjj_C03D6.8 RNAi JA:C03D6.8
Simmer:C03D6.8:Screen_A
Simmer:C03D6.8:Screen_B
PCR_productsjj_C03D6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC03D6.1 Source_evidenceePCR73WS150 Sequence/Annotation Release
Overlaps_Gene C03D6.1 Source_evidenceePCR73WS150 Sequence/Annotation Release
C03D6.8 Source_evidenceePCR594WS150 Sequence/Annotation Release
Chunk_score Abs_score521
Max_abs_score521C03D6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96690909670172
Overlaps_transcript C03D6.8.1 Source_evidenceePCR594WS150 Sequence/Annotation Release
C03D6.1 Source_evidenceePCR73WS150 Sequence/Annotation Release
C03D6.8.2 Source_evidenceePCR584WS150 Sequence/Annotation Release
WB_DNA_textsjj_C03D6.81083ctggaagatttgatgcagtctctatatatgttgatatttcttctttgaaagctgtgaactcttgatgttctacctgaaaacttacgatttcttctttggtacatgatttccaatttgaatcaccgcgcttttatcaccgacgcaaagtgcgcaagcaacactcgctggcgcctttctctccctttgcgcataaggcgatcgcttttttattttttcgcaattcttgattctaaactaattttgttacttttcaatgttctcactgtccaatttcaccgtattttgcgttaataaattattttatcaattttaggtaacaatgcgcattgaaaaatgctacttttgctcgtctcccatctacccgggacacggaatccagtttgtcagaaacgatagcacagtaagaactatttaaaataaaattagtttacgaactgttcaatcaatctgtttaggtgttcaaattctgccgatccagatgtaacaaattgttcaagaagaagaagaacccaagaaagcttcgtttcaccaaggctgcgcgtcgtgctcgcggaaaggagcttatcaacgacgccacacagcttctcgaacagcgcagagatgagcctgtcaagtatgaaagagccatgttccaaaagaccattgaagctgccaaaacgatttccgcattgaaaacaaaaaggtaaataaaaataaatttatatcaaaaagcaactattatttttcagatatggtaacctgatcagaaaacgtctgcaaccaggaaagattgtacagaagaagggactccttgcgaaggtcgacaagaaaatgcatctcatccgtgctccagttgcaaacagagatggtgtcaagacaagggcggcagcaaaagaaaagaaaaccgcagaatcgatggagaccaattgagtacccaattttctttctttttttaaactttttgttatttgttacttgttgttctactcccgcttttgtgaatacacttggatttacgattttttggaatttcttgttatattcactactggacaggaaaaagcgtttcaacgaaatactaggtggtggtaagattattggtca