Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04F12.3   

sjj_C04F12.3RNAiJA:C04F12.3
PCR_productsjj_C04F12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04F12.3 Source_evidenceePCR1474WS150 Sequence/Annotation Release
Overlaps_Gene C04F12.3 Source_evidenceePCR1474WS150 Sequence/Annotation Release
Chunk_score Abs_score1310
Max_abs_score1310C04F12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96862679688439
Overlaps_transcriptC04F12.3 Source_evidenceePCR1474WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04F12.32173aacatgttctggtgctggttagtttaagttacagtcggatgaagaaaatctttctttttaatacaggagacgccactgaactcatcacaattcactttctaggcgatcaatttgaagagagtgcaattgatgttgttaggaaacattcggtaaggaccgtttcgtaaaagggaaaactgaaaaaataatataatttcaataaatgataaaattcgcattgaaattgtacccattctccgtaatctgtaacaaaatctgtgtaaaaacttatataattaatgatgttttacagcttgtaatgttcacagtcccttctctgaaagtagactcagaattggaagtggagctcagattttcaacttcaaatgataatgtgacaacgatttctttcaaatacttgccacgaaaaatccaacgttcgcatactcaggaaatatcgctttttgacaatttacttgaatttgccaccaacggagacacaatttcattacttcagccttttgtagcacaaatttcaaaacaagatattgaaggaaatacgtaagatttcaagttttcctctcctttacaacattcataatttattccagagtattccatgtggcagcgaagaatgggcagagcttctcattaaagcttctactttcagtgattccacccgatattaaaaatggtaagatgttttgagacgaagctatttaaagcacctgtgattgaattggcataaaaacttcagtatttatatcaccaagacgcgaaatttcgcattttttcgcgcagaaaatacgacacgacaattttttgtaaattttcatagtttgttttgaaggttatatttaacaaattctgcaaagacagaagtttgatattacagtagttttcttaaaggtgcacaccttttctcatttagcaaaaatttgtcgtgtcgagaccggagatcttatttttggcgcaatattttgcatatgggtaatattttcagaagtgataaatgtacaaaacacacatggtcttactgcactacatgtagctataaggactggagatcccgatgctgttcattatctcatgaatcatggagccaaaattgacatatcagataatcatgggagcacagtaagtatataacagacaaaatgttcgctttgtgtagattattcaatacttctcaggctctacattatcttggagatgcatacaatgaatcaattttcaaagaaatattagaaccatctagaggtcaacggtttgatgtgaatcagctgaattcggagggatttgcaccgattcacgtggcagtaagaaggttgaagctgtcgttgattgagatgctcattgaagcgggagcattgattgattttttggatactgaaaagaaaagaaatgcgttgatgcacgcaattgaaatgaatgattttgagactattcagcttttggttgaggtaactgtacatagaaaaacattgttttaaatttaatattttttcagagaggatcaggaacaaatatagaagatgaatctggagagactgcattgagcttggctgtaaaaaacgttaactatccagtgattggccttcttttagataatggagctgatccgaatagacaaaattctaaaggaatatgcttggcagatagtgaagatagtgttattcaaaacattataaatggagatagacccgaactacccaagaaagaagcttttggtgttcctaatgatttagctatttctagatctcccttatttgggagatctcatccagatcaggctccaggtgaagagagtgggcggcacagagttgtgaagagatctagagaagaaatattaaatggtatgttttctgaaagattttttgaaattagatccgtttttgtagacgctcaaactcttctcgctgaaactgactccatggctccacgtgtttcgagaatatccacatctgaatctgaagatgagcaacagccgggaccctcaacatcgtcgggaacacgaaggcgtcgaagtgaatgggatcggaatccgaagcttagtgattcggtctgcaatttagattatttgacccgaattcgcgttgcaaaaatatttgatgatcagtgcaaatggcaaagattggcacaacaactcaattgtgatcacatggtggaacttatttctatttgctcatcggga