Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04F12.9   

sjj_C04F12.9 RNAi JA:C04F12.9
PF:GL1_1B5
PCR_productsjj_C04F12.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04F12.9 Source_evidenceePCR420WS150 Sequence/Annotation Release
Overlaps_Gene C04F12.9 Source_evidenceePCR420WS150 Sequence/Annotation Release
Chunk_score Abs_score336
Max_abs_score336C04F12.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI97099549710841
Overlaps_transcriptC04F12.9 Source_evidenceePCR420WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04F12.9888acttctcttcgagaccaggacttgaaatgagatacactatatcagctaccgtactcgcgattcttgatattttcaagaagctttcccagtgtttcggagcatattccttcaatccaagaaagtttatccactattcatctttattgcttttattcaaaaaggaaagatgcgggaaaaatagagggcttgggtactcaaatgtacattctattgctatgtccgcggacatgctcgaactcgacagtctgtaatttttaattatttccattaaaaagcggtgttttatgaattatatataataattataatcttacctttccactatgcttgagcgcttgaacattgcggtcgatatctctgatgagatcctgattcttcacatcttgtcccgaagaagttttgtagccattcgacttccagttgtcattccatttggtgacagaatccttcgcgttcttggaatcagtgtggattctcacgtggctgtctggaacatcacgagcctgaaaatgcagaaaattgaatgttggtacgaatgtttgaaaattaccatttgggtggcgtgcttgatggcttccagctcatatcgattgttggtttgtggtccgtgtggataagagccactcacattcttcgatgtatctgaaatatgttcaaataaggaacaattaattgcacaaaaaaccgtaccacttggaacgtgaactccatagcctcctctggagccttgttggccgtttccgagagcggaaccgtcggtgtagaagtcgtacggcatttctttaaaatttcagttcatttgataggaaaaaagcatgcgagagagaaaagaagaatgaaaacggagatcttaataaaaacaaaatgatgatatgaattgtttcgcag