Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04G2.2   

sjj_C04G2.2 RNAi JA:C04G2.2
[cgc5655]:C04G2.2
PCR_productsjj_C04G2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04G2.2 Source_evidenceePCR781WS150 Sequence/Annotation Release
Overlaps_Gene C04G2.2 Source_evidenceePCR781WS150 Sequence/Annotation Release
Chunk_score Abs_score697
Max_abs_score697C04G2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1009138510092473
Overlaps_transcriptC04G2.2 Source_evidenceePCR781WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04G2.21089gaacaaacgacccaaggagagattcacacgtggcacatggtcccggattggaattcaatgtctgtacgggcttaaatacatgcacgactgtggatttgtccacagagacattaagccgcagaatttcatgatgggtaatgaggatgacaaggaaagagctagaattgttcacattttggactttgggctagcaagatcttttgccaagtttgtgagttgtacatcgaggaattttataattggaatagttataccttttccagagcgagtcatcaaaaacttggagtgctcgtcgtgctcgtggaactgcagaattccgtggaacacttcgttacacgtccccaaatgtccattttcgtaaagaacaaggtcgagtcgacgatatctggtctctactcttcgtgctcatcgagcttaatggagggcttccatggcagaatgttcagaagagagaagaggttgaagcaatgaaaatgataatgacagatcaagatgttatgttgaacatgcctccttgtatgtgtgacatcattcctcactttcgtacacttgactgttacatgagaccggattatctgtgagttgaaaaaacaaaatatttaaaaaaaaaagaagattttcagtttggtgttcaaagctctttggcaagtgatgcttaatgaaggacagactacaagctctcgcttcgattgggaaacttcggatccagatgtatagcttgcttgagatatctcttcctatacattctctttcagccatcaatctctccggcggattgggaaaatccagacggtcgtttcttcaaactggacaaaatcggaatcaatggaccacctcccatggacaaatgtgctgcggagtcaactcaacaaggggatgctctgaagagtgataagggaagatcggtgaatcaaaagaaatagagatgaagaagataacttgtgtttgattccaataaaatgacttgtgataatttcttgttttatttgttacaaactggtctttaacatacccgaaagatttcaaagtcgggtggtcaattcaaaccaacaattgaaaataatttcgggcttgttccaattgtccgat