Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04G2.4   

sjj_C04G2.4 RNAi JA:C04G2.4
[cgc5655]:C04G2.4
PCR_productsjj_C04G2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04G2.4 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (28)
Overlaps_transcriptC04G2.4 Source_evidenceePCR452WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04G2.4721ctgggacagtgataagaaggttgctataaattgagaatattttgccataatcttcatagagttttcataactccttcatcgaacgaccatggcccaatccgtcccaccaggagacatccaaacccaaccaaacgcgaagatcgtctttaatgctccatacgatgacaagcacacctatcacatcaaggtgatcaactcatcggctcgtcgtattggatatggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgatccaaaggaagctgtgcttcttgctgtttcctgcgatgctttcgccttcggacaagaggataccaacaacgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgtcgtgaatggttccagggagacggtatggttcgtcgcaagaaccttccaatcgagtacaatccataggatgtgtgaactgggtttcttaacaataaacttttttcaagtatatgttctgtttttctgttttaatctgcaaattgaatatatattaatactcaagcgaacaagttttgtgttccatcgatgcccttaacataagcatccgggatttattgtaaatcgtttggaactatagtaatcctaccttaatcttccagtagtcattcagttcagaagactacccaaccatactactaacccagcccatctctc