Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C04H5.6_b   

sjj_C04H5.6_bSequenceCTTGGCAGCACGAATTAACA
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_C04H5.6