Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C05C8.7   

sjj_C05C8.7 RNAi JA:C05C8.7
Simmer:C05C8.7
PCR_productsjj_C05C8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C05C8.7 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score Abs_score816
Max_abs_score816C05C8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV72459237247079
Overlaps_transcript C05C8.7.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
C05C8.7.3 Source_evidenceePCR762WS150 Sequence/Annotation Release
C05C8.7.2 Source_evidenceePCR762WS150 Sequence/Annotation Release
C05C8.7.4 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_C05C8.71157tattaccccgtaattcggcacacggatgatatctttagaatattatcagtgctcaaacagtgaaaaatatttgaaattaaatgcaaaacaaagagattaaacaacagcggtgatcgcttcttccatatctgcatctaatttgaacattttctcagtaatcgtaggcaccgcattttgaactggagtgacgagccgtgtgtcatgatctggtcccatttcgtaactaaacgtcctgtatccttctaatggttccgagcagcttgagaatctaaaaataaaacatttgaaagtagttgttgaacaggaagtttctaattagtttcgtgtcgttcctttcttaatctttagaataaaacgaattggatactggcaaaaacttttaagaatgagagaaaatacatttcaagacaaaagaatatggctaataatgaatacttctaggaaggagaccacatttaatatcaaataatttataaaagtttagatatagtcgtacttacctgatattatgctttggtggaatatagaagatatctcctcttttaacttcatactgtccaatcagctgattgtcaattgtcgcctcttctagtgtaccttttccgctgacaactacaaagatggatgcgcaatcaagagttggaatcatcatttcttcaacagtctgatgtgttcctactcgtattctatgaagttggaaatctttacaatctggtgcatacatatcaacacattcagtcaacttgttctctggcaccaaataatctttttgctctgtcatcttgtagttaagaacactgcaaagagcatctctgtcaatgtattttggagtcatggcggcccgaatcgtattgtttgaacatcccacgcattcaacacattcaccactgagataggcatgaagttcttcagcagcataataacaacattgtcctggttcgagaatcatgtgattgaggaaaagtggggagaagattccaatatcatttggaaaatcaaccgacatttttcgaatcactcctactgttacttcttcaactgcaccacgaagcccattgtcaagttcggaaagaagctttgcaatcaggtcctggaaatttaaagtttaagttagaaaatgaaatacaaaactttgaaaggatttgcaaacaggttgc