Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C05D11.12   

sjj_C05D11.12 RNAi JA:C05D11.12
Simmer:C05D11.12
PCR_productsjj_C05D11.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C05D11.12 Source_evidenceePCR947WS150 Sequence/Annotation Release
Chunk_score Abs_score884
Max_abs_score884C05D11.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64457326446857
Overlaps_transcript C05D11.12.1 Source_evidenceePCR947WS150 Sequence/Annotation Release
C05D11.12.2 Source_evidenceePCR933WS150 Sequence/Annotation Release
WB_DNA_textsjj_C05D11.121126cgcgtaatcaagagcaacaacgaaaccaacggaaacaagtggttgtccttgatcctcgatatggtacaagaaggatcctccgtattgatcaacattctgaaaaatcattttttagagattaaattctagaatatatcttttaatctgaaacactcaaaaaaaaagctcacattttactagatttttcaatttttcttaattttttagatcttcagaaacttaccaatggccatcccatagtatgctcaacataaccaggtctatgctttgctggatcaatttcccaaagttctttgagtccaattccataagtcattgcatgtgttctcaaatcaaatttatcgagaacttgcttgctcaaatgtcctctacatccttcagcgaaaattgtgcatttcgcgtggaattccataccacgagcaaatccatctttcggtgctccatcctttccaattccaacgtcacttgtggcaattcccttcacacttccatcttcattgtagagcacttcagatgcagcgatttctggccaaacttcgactccagctgcttcagcctgctcgccgagccattgaacgacctttccaagacgaacaatatagtttccgtgatttgcaagtggaactccaggtagcactggaactggaattcgaccagattcagtgagaatagcgatagattcagaggtaacttgttggtaaactggagctcccagctctttccaatttggaataagttcatcaagagctcgagtttcaattacagctcctgagagagtgtgccctccaataacagatgccttttcgacaacacagacacgaagttctgaaattaaaaaaaatatgtttactctaaaatgtatttgtttagattttacctttctgagctttttcagccaattgtctcaatcgaatggctgctgataaaccagatggacctcctccaacaatgacaacatcataaacatcactttctcgtgccaaatcaacatccttccaccgtggatcagtggatcgatcctttacagtatagtgagtagtcgtccattgtccgttgacgacgttgcgaagttgtgatgagacgcggaataatgtgactccacttatccgcattctgaagtcacaga