Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C05E11.1   

sjj_C05E11.1 RNAi (8)
PCR_productsjj_C05E11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05E11.1 Source_evidenceePCR803WS150 Sequence/Annotation Release
Overlaps_Gene C05E11.1 Source_evidenceePCR803WS150 Sequence/Annotation Release
Chunk_score Abs_score698
Max_abs_score698C05E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX45889844590131
Overlaps_transcriptC05E11.1 Source_evidenceePCR803WS150 Sequence/Annotation Release
WB_DNA_textsjj_C05E11.11148gaaaacgtatgtggcgtgtgctctgatgttgggagcaattggtattgttcttgctggtcgctacgtgattaacggatttttctcgtggaggacaaaccgtaccactcaaaaacttgaaaatgcgatttcacagaagactacattgctggatcttgttaaagaaactctgaagtttaaggtaacatatttagaccaaaacattaaaagtttaaatttaagtcaactttattcaggaagccaaggagatattggaccgatatgagaagatcgaacagaatacgacaattgacaaaaatgattcaacactcaaatcgccatcgcctatcaagaagcttactgctgactcgtcaatgtttgcaactccgaagcaagagcaaaaaagagttgaaactccaacggcgcaaggtccgaactctgccatgaactcggtaagtgaaaatatttaaattgacactcaattttgaatgtgaagtgggacaattcataactaaattaccgaccacatattttatctgagagattctgaaacctgcgccaagtagaagcacagtcattgatattttggcaaaattacctaactttatagacacttaaacaaaatgtattctttcagatgaacatgaccccttatcaccagcggaacagaaatgctgtcccaattcgtccattccttcgccagacaactgcctttgacagagtgcttgactattttatgtccgatggacctaactgcaggtttgttgactcgtaataagttataccaaggtaactaatgatcctcatttttcagaaacgctttgatttgctccatttgtcatacacataatggaatgtcaactccggccgagtatccatatatatccttccggtgcttcgaatgcggacatcttaatccggccaagaaaatggggtatgtttctctcaaaagttccagaaatagttttgtagatatattttcagaccacaaattccgttgactcgtccgccgatgggtccaaagggcattcaacacaatggaagagttggtccgtctgaaaatactcacaatatgatggagaatcagaagccgtcaactgacctaaccccatctgccagtcaaaatggatctgaaaaaggatcagactcggaaaatgagaaggtcccggagt