Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06A1.5   

sjj_C06A1.5RNAiJA:C06A1.5
PCR_productsjj_C06A1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06A1.5 Source_evidenceePCR414WS150 Sequence/Annotation Release
Overlaps_Gene C06A1.5 Source_evidenceePCR495WS150 Sequence/Annotation Release
Chunk_score Abs_score474
Max_abs_score474C06A1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1057894310579773
Overlaps_transcriptC06A1.5 Source_evidenceePCR495WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06A1.5831gaattcaaattgcctctcacaacgacgttccaccgttacgccttgcgtcttgtttaacgtaaatccacctgaacaatttcgtagaaccaattttctttcttttgcttttttgcttttcctgaatggaataaattgaaaatatctttaaaagttttaatatttaacaaattgataatttttcactgttacaataatctaatgttgaatcatccgtgtagaaatatctttaggcctggttctgtattgattttcctatttatatttgtatcactcttgtatttcatttgattatcggttttttcttataaatgttaagaaataactagtaaattcaattttgcagactcagaatggccgatgaggacgattatcaagatatggataatgatgatttcgttgacgacaacgaaatggaggacgtgatcgaagaagatccacaacgccctgacaatgaggacgaggacgatgacaacgtggacgagaatttcgagcttttcgatcaaggaaaggctgttccgactagtgagcatgtgacaactccattcatgacaaaatacgaacgagctcgagttcttggcactcgcgctctccaaatcgccatgggagctccggttatggttgaacttgaaggagagaccgatccattggagattgctcgcaaggagcttaaacaacgccgtatcccgatcattgtccgccgctaccttccagatggatcatacgaagactggccaaccgatcaacttcaactcgctgattggtagagaaatgtttctctaatttttcctcattttaactgtttcaccttttttgctctcctcatttctgatc