Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06A5.5   

sjj_C06A5.5RNAiJA:C06A5.5
PCR_productsjj_C06A5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y76G2A.1 Source_evidenceePCR379WS150 Sequence/Annotation Release
C06A5.5 Source_evidenceePCR379WS150 Sequence/Annotation Release
Overlaps_Gene Y76G2A.1 Source_evidenceePCR379WS150 Sequence/Annotation Release
Chunk_score Abs_score274
Specificity_index0.355
Rel_score0.867
Map_statusBest_ePCRI59794975980103
C06A5.5 Source_evidenceePCR379WS150 Sequence/Annotation Release
Chunk_score Abs_score316
Max_abs_score316C06A5.5
Specificity_index0.41
Rel_score1
Map_statusBest_ePCRI59818535982459
Y48G1BL.4 Chunk_score Abs_score70
Specificity_index0.091
Rel_score0.222
F14D2.9 Chunk_score Abs_score111
Specificity_index0.144
Rel_score0.351
Overlaps_transcript Y76G2A.1 Source_evidenceePCR379WS150 Sequence/Annotation Release
C06A5.5 Source_evidenceePCR379WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06A5.5607tcaacatggttcgtgtctacatcggtcgtttcccaaatagagcatccgatcatgatgccgagcacttcttctgcggatatgaaaagctgcctgatgccataatgaagaacatatttggtgttggttgtaagataactattctcatcagaaaccctctagaatgttataatttcaggattttcaagatcggagcgatgctgacgacatcatttttgatgagcagagaagaattttgcttgtggagaagctgaagaacgcgaaggaatacccaacaattaatcacgattagctagcttgctagctcacagatatgggtaaaaacgatttcgtacaataaattgaatcaaatatattaattttcagaagctcaatggcaggttggctccgtgatcggctggtcccttcgatgtctgattgcagttcattgcttcagagagcagcggcggagttttatcaaaataagatggtttaatagttttcaaatttgttcgaaaaatattaaattatttccagagcgatccgctttgcaattgggatcaattgaatccggagcatgtctcaatggtggccgctcgaatcgccaagttttccaagagaagtcggatct