Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06A5.7   

sjj_C06A5.7RNAiJA:C06A5.7
PCR_productsjj_C06A5.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06A5.7a Source_evidenceePCR792WS150 Sequence/Annotation Release
C06A5.7b Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene C06A5.7 Source_evidenceePCR792WS150 Sequence/Annotation Release
Chunk_score Abs_score687
Max_abs_score687C06A5.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI59948375996470
Overlaps_transcript C06A5.7b Source_evidenceePCR792WS150 Sequence/Annotation Release
C06A5.7a Source_evidenceePCR792WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06A5.71634atgcgaatgggtagcaaaacttgaataaaattagaatttacccaaattgaaaatttttcaaagataaaaaaaacaacaaatacctgattatctgctttaaattcaacaattgattgtgtcacaagtgttgatcgcagcaatcgagccaataattcaggagtcaggaaattggattcaacattcagaacacgaagggatggtgatgtttcgataagctcaatgagtccctggaaaatatgagaattcgtttttttttatcagatgacaaatactattttagaaaaaaattaaaatgttcaagattgctatggaattgagaaattatttcacaaatcaatgcaatatctttcaactcgataaatttttaaaaaattttgttttaaaaaactcactctcgcttcagaatccgaaatcgctgtgttggccaatgaaaacttttcaatatgtttactgttgcatgccgcctcgatcagtgatcgaatacgttcctgaagtttggatattttttcaaatttctgatttggaaaaaatatctaacaaaccttcgacactcgtttcatattgttaatattaacctccttcaagtctgtatcgtcttctcgtaaccggctgaaagttggaaacatagtttagaaatgtttagaacttgaaaatttttcaagagaaagtccagggaaccagagatttgaaatatttcagggcaaaacaaaaacgtggtttttttttaaattttttaagctgattattaacgcgaattgaacaataaaatctattttttaaattcgttttttcctattaaaacatttaaaaactcacttaatacatgattcaacatcagtatcattatcaggctcatcgggaacaatacgtggaacatatgattgcataattccattaaatgtcgttcctgtcgactcatcttgtgtttttccttttagtgcattataatattgtggttgattgagcacattgtgcatacctgtaattaattaattaataggaaatttaagattatttcaaaaagaaaaaacgtaatattaaaattaaatcttaaacaaacccaaaattccagccaaatcaacgagatccttttcaggggcagttacaagagcacactcgagctcttcttcatcatcatccaaatcaatttcaattggcatctccattttaccattttcaggttcttctgaattccgtccactatcactatcatacacttttccacgtttttgtccaggcgtataggggcacacatcttcccaatctttttcggttttagccttatcttccaggaattttagtaaattatctcgtttgtaaggtcccgttggttctttgtctgtttgatcacgacaacgttgggaaggaggaagcattgaattctggaaattgagaatttacattttattttaaataacaaattttatttttcctggcgctctgatttgggaaaatattttctatgtttcatagacattttattcgttttagttagaacttttttgataaataaataactcattttgactacatttttccgatttttgaaaaaggacacattttgattaaatttttttctgaaacaaaaacaccttttgaatgaaaattattcaacgacaccctggattctgatt