Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06B3.3   

sjj_C06B3.3RNAiJA:C06B3.3
PCR_productsjj_C06B3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06B3.3 Source_evidenceePCR702WS150 Sequence/Annotation Release
Overlaps_Gene C06B3.3 Source_evidenceePCR702WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1389983813900737
Overlaps_transcriptC06B3.3 Source_evidenceePCR702WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06B3.3900ccatgacttggggattgttcaaaaattggatgaatgcagacaccagagttgttgtcgttgtttcttggccggttatccatagatcagttatcaacattttcaaattgttctcactgaaataatttgatattctcaattcactcaacgcatcacttactcataaacatcacttttcggattttgtttcatcttcaataaaaaggcatcaacgatatcctcaacgttatttggatcaatttcatagtcaccattcatgaaatctcttgatctttttatagcatccactgacacataatcaattatctcaaactgatcttttataatggaattaaaatctttagcgagaaacttttgaagagcccaaactggaagagtgaaaaatagtggtgtcatcttatccattccttcatcaaacatgtgtttcattgtgagaaatcgggattttgttctctgaaacgttaagaatatgcttcgttctctaattgctatatgcttacttcatcaaatcgaaatcctaagagcatattgttaatgatacttccaacagttaaatcaaagaattcattcacttgtaaaacagtggtcccatcaatagatttttcattgatttcagcacatctgaaaattatggtgattggtttatggtgaactctctttctaattttcggttaatggtaccttgcatcaagttcacttagaatcttctcctccatcaaatctcttcccattcccatatttctcatcgttaacatggagaatcttctcaattcctgccatttgtcgccattcgagaagaacactccatttccttctgaaatttaaatcgatggatgttaattatctcattttctcaaatacttctaacatagtcaatcatcggggaaacatgcttatcggcat