Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C06C3.1_b   

sjj_C06C3.1_bSequenceGGTGGAAATTGCAGGAGAAA
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_C06C3.1