Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06E7.4   

sjj_C06E7.4RNAiJA:C06E7.4
PCR_productsjj_C06E7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06E7.4 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene C06E7.4 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598C06E7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV58509175852090
Overlaps_transcriptC06E7.4 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06E7.41174aaacgcaatactgcttcggtaacgacgatcttcagatgaatgctgctgctgttgcttctgaattcgataaattcgacgttcagcaggaccgccaatctctttcgtgtggattgagagtggggaataatcagccggtgggatttcagacgtcgtcagtaattgatgactggatcgtgacaggaatgactggaaaatatctaattattaggagttcaaattacaactattacagaaacaccacaaaattctacgcgcaagatatctcgtagcgaaagctacagtaaaaaatcctaaaattactaatactatagcgcttgtgtcgatttacgggctctttttggcatctttgatttatttatcggtagaatgttaaacaaagaatgaaattaatacgaagaaacgaaggaaatcaggtcagtaaatcgacacaagagctaccgtagtcatttaacgaattactgtagttttcgttacgagatattttgcatggtcaaatatgtggtgcaatacgcattctaagaattttgtgcttccgtaataactaaccggctccttccgatcatttcttcttgcttcaatctcgaaagccgcagtcttttccagcacactactcttccgtctgtttctcttctcatcgttctccttctcattatcacttggaactggtggaggatccattccgaagtagaattcaggaagactatcgattcctggaatattattatttagtcaaaaatcatcgaaaactaaaaaaaaaccaacgttttgattctctcttcagtttgtcctcttcctcattaacccatgaaaaatcaatttccgattgatcacatctcatttgtgacgtggcaattgacgaagatctcgagccatatgatggttgacgacggattattggttgagcatatgttgcatttgaattattcaatgtttgattatgttgaatccgtgatgacgttgaagaggctgtctgggctgcagttggtggtgctctttttgtgggctccgacacctgttgctccactttttcacttcgctcaacttttacttctatcgtttttgtgattggctggaaaagtaaaaacataggattcaataaatagtattggggaaatttttaaatcttacaggttgtggagacttgatgacctgatgatgctgaagttgctggtga