Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C07E3.2_b   

sjj_C07E3.2_bSequenceTTGCCAAAACCACACAAAAA
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_C07E3.2