Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C07F11.d   

sjj_C07F11.d RNAi JA:C07F11.d
Simmer:C07F11.d:Screen_A
PCR_productsjj_C07F11.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC07F11.2 Source_evidenceePCR777WS150 Sequence/Annotation Release
Overlaps_Gene C07F11.2 Source_evidenceePCR777WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714C07F11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI421549422511
Overlaps_transcriptC07F11.2 Source_evidenceePCR777WS150 Sequence/Annotation Release
WB_DNA_textsjj_C07F11.d963ctccaatttcaattttcagaacgaagaagacgaagaagtggactacgtggcagttgacctttacctggtagatggtcctgtaaatgaggtgaacgttatggccgaggtgggggctctagagaaaacatccacagcaacgttgggaagccttcccgcaggtcagaaagaagcaaagactataaaaatgcaaaagggctctggttgtgagataacggatgcagatcgagaatgtgtgtcgaagtatttgaaagagaacgtggagaatatcatcaaaatctccataattataaatatggagacacgacttttcgaaccatcaacctatttggatgcaatatctccaactcctcgagcatcatttctaacggcaaattacaatgcgagagttaacagtaaggtatggaaaaggcgatcacggaaaaggaatggaagaatcgagcgaagagtgttaagtgataaagagaagacgaagtatgagagtaaagtacaaatgatattggatgaggaacgggagaagctgtgtgataaacgagagatgttgaaggaggatgatggtggatcgagaagagcttcgttgatttctcagttcagggagaatcaacatgaatctgtgttggatgatcatatgttcaagagggtaaggtttttatttttaatgcctaaaactttgagattgaggcagttcaataggctatatacatataagtgtggacccaacaagtttgttacatgaagtattttttccagatcctcgttagctgctgtgaatcttgcgagcaacgtcgtctatcgttcatgtgtgacagtcgaaccgaggatgattctgaaggggaagattgtgaagacaatgaagaagatgatggagaaggtggctccgatgatgaggaagacgatggagaggagcctcattttgaatgtgataagagtgataaggagcatgtccacgatgtaggtctcctttaa