Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C07H6.5   

sjj_C07H6.5 RNAi JA:C07H6.5
Simmer:C07H6.5
PF:GL1_4D4
PCR_productsjj_C07H6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C07H6.5 (3)
Overlaps_transcript C07H6.5.1 Source_evidenceePCR979WS150 Sequence/Annotation Release
C07H6.5.2 Source_evidenceePCR979WS150 Sequence/Annotation Release
WB_DNA_textsjj_C07H6.51172tgaaggtaagtctcggcgtttcttgggaagtcaaagttgatgacaacattgacagcctggatatcgatacctgaaaaattacaattatgcatgaactacactttaaaataagaaaaatggcgctcagatatccgttcttcaattatctcttcacataacttcagagtgtgtgtatgtgttatcaatcctcatcgcgcaaattatttagtcaaacttaccacgggtgagaagatcggagcaaaccaagtttctgcagtttccttgacggaagtcatggaagacacggtttctgtgattctgagccatcttggaatgaatgtagtagcacgagtaaccgatttccgtgattttcttagcgagaagctcaacacgttgagtagagttacagaagatgatcgactggttgatttgaagttttcggaacaacgtattcaaacagtggaccttttgcttctcttgaacaaaggcatagtattgggtgacaccaagaagagtaagctcctccatgaggttgatctcatacggcttgtgcatgtgcttctgcatgaacgaagtgacggtgttagggaaagtggcagaataaagcataacttgacgctcctttgggaggaagttgatgaggcggtcgagaattccctgtaaacgagaattgttatcttattcaaatgttaatttttttacctggaagtcttgactaagaagtttgtcagcctcgtcaagaacaagtgttttacaatgttccattttggcgactcctttctccataagatcgagaattcttcctggggtggcgatgaccaagtgaaccgttccgtttagacgcatgatatcatcacggagatcagttcctccggtagtgaccataactttgagctgaatgtgtttggagagctccacgcagatctgtgaagtttggagagccaattcacgagttgggacaatgaccatggcttgaatagctttgagggctggctggatcttctcgataacagggatacaataagctccggtttttcctgttccgttcttagctcttgcgagaatatcttgaccagtgagagcgactccgatggatgcttcttgaataggactcggtttttcccatcctttctcaaaaatccccatgagaagatcgcgtccaaggcagaaatcctcaaactcgactcccttcg