Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08B11.3   

sjj_C08B11.3 RNAi JA:C08B11.3
Simmer:C08B11.3
PCR_productsjj_C08B11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08B11.3 Source_evidenceePCR823WS150 Sequence/Annotation Release
Overlaps_Gene C08B11.3 Source_evidenceePCR826WS150 Sequence/Annotation Release
Chunk_score Abs_score784
Max_abs_score784C08B11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII80268008027910
Overlaps_transcriptC08B11.3 Source_evidenceePCR826WS150 Sequence/Annotation Release
WB_DNA_textsjj_C08B11.31111cctcatcgatgtattcggcttcgatttcacgatccaaaaatgtcatgagcatatcaaggggcactccggaggatgcccaaaaatctcggaagttgtgtttagttgtcctcttccattcttttcccatgtcagccatagtttcatcgtcttctgaaaaaaaaacttttaaaaaaatactgaacaaaacgacaaaccatcataaacacccgtatgagcaaccaataaagttagaagagttggtgcatgacatattcgcaattgtttcggaccagcatgtgacaagagcatacaaacattcattgcaaaatcgatttcgttcggcaatccagatatcagagactttgtaagtcttgcatagtccggttcattgataatctgtcctctctcatctctgtgctggtattcttggaccatccgattattactaattggacattcattcgtagcaaagaatgaagtagcatttcttccacgacttcttgacatttcattgtccacataatcatcaacatctccgatagtttctacttgttcgaatttcgataaatacctcatatagattattttgatcgcatgatctccacacagaatatcatctttgcatccgaacatttcagcgatatcagaccatttgtcgcttgcagctactttctgccatccacccaatgccataacagtgtcatatagccgatagagattcacttcaactccttgaacatgtggaagctttagtgttgcattccaccttcttttgtagaacattcgcaaactattataaaattctgccatctttctctgcttctcaggtggatccgtcaatttgtcgatgtagtgctcgagctctgatttccgtttccgactctccattttcaagtgtggttctgaaaaaattatcgtattacatgaaatataaaaaaaatttagtggtgcgctacaaaacgatatggatcaagaattaagagcaactttgagtgagaagagctgagacaatttggatatttttgaaccggagcaatgcacataaacaactgcagattaaataaacaaggaaagagggcaggtggcagaacgggagaaatactcattatgattgcccaacgtcgatatgtta