Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08B6.10   

sjj_C08B6.10RNAiJA:C08B6.10
PCR_productsjj_C08B6.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08B6.10 Source_evidenceePCR423WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcriptC08B6.10 Source_evidenceePCR447WS150 Sequence/Annotation Release
WB_DNA_textsjj_C08B6.101986gaactaatggacaaacgaagacggtaaaatgattcaacgaaaatgtgttttggcattgatttttattttttgtgttcgtgaatctgaacagaggttagttttttgttttgcttttcgtttgattatgttttcaattttttatttcgagaacacgaaattctgtgaatgtgtattgcgtaatatatctcgttgcgaaaactacagtaattctttaaatggctactgtaacgctcatgttacgagttcaattttaaaaaatttttgaaataaatcattactctcaatagaatatgggaaatcatgcaaaaaatgagaaaataatacgaagaaactatttatggacaatggaatatcgatgtcccttttcgaaaagaaattcattacacaaatcgagcccataatttgacaaaagcgttatttatggtacagttttgaagaagtactgtagttttcgctatgggatattgtcaaatatgttgcgcaatacgcattttccgatttttgcgttcccataaaagttttaaaaatcgataaattaataacgtttaatttattgagtatttcttgataataaaacagtaaaaatataattgttatgtgtcttgttactcaataccatcagtggtaaatgagactttcaaatctggcaaataggtttttttcggagaaaaaattggttcaatgaggtaaccaacactttttagttcagtatacaattaattccctcatttataagtaatgatgtattttttggaaatcgtagcgatatcagaaacacaaactgaagtgtgtattgaaagtaacatttttacgaataccgtatatcttctattaatatggcctccctattagacttgcactccctattagtattgcccctcggagaccttccgaaaattagtatggcactccctattagtcttgcactccctaatagccttgcgtttactattttttattgcaggcccgtcttgttaacttcaggatttcaacaaaaaaatttgcctattttgcaacagtttttcacaacatttctacgagattgaagtttttgaacttatatgttacaattaaagtcaaattttctgaatttttacataagattcgagctttttcagaaaaaaaactagtaagctcaaagtcagaaaaatgttctgaaaattagtattgcactccctaatagtcttgcactccctattagtattgcaagcgggaagtccatcgaaaaatagtattgcagccatattaatagaagaaacacggtatatgataagcattttctaaattccgtagcgactgaaactttgaaaaattgctaacaaatcatcatttactatatataaagcgcgtattccgtttgtccatagtttgtagtctatgtagtctttgtagtctgcgaagttttagcttctggagggatagtgagttggggttagtgtagggatatagtcggggtactgtagtggtacaatggtggtacggtaggagtactgtatgattacggcagtttcagaaaaattggttttcagctccagaagtcgggggccgcgccggaggtgcggtccacggctggtaaataatataaaaacaaaacattatcaaagtcccaataaataatttcagaggaccaccaggtattccttcgccagccaatcctacaccttcaaatccggtaaccgctgctccaattagacggcaaccaactgtaatacaaacaacatgggctccacagatacagcaaccccagcagcagctagagtctccacagaataattgggatcaacaacagcagtcaacagatgaagaatggcgtcctgattggagagacagaggacctccaccaccagattttgatggttggcatcatcatcatcaccatcgtccaccttggatgcggggcccttggtggcgacgcccgccaccaccttggggaccgcctccaccagggccgcctcctccattcggatggagaggactttgagaaat