Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08B6.4   

sjj_C08B6.4RNAiJA:C08B6.4
PCR_productsjj_C08B6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C08B6.4a Source_evidenceePCR842WS150 Sequence/Annotation Release
C08B6.4b Source_evidenceePCR842WS150 Sequence/Annotation Release
Overlaps_Gene C08B6.4 Source_evidenceePCR842WS150 Sequence/Annotation Release
Chunk_score Abs_score758
Max_abs_score758C08B6.4
Specificity_index0.53
Rel_score1
Map_statusUnique_ePCRV1011861510119628
Y50D4A.3 Chunk_score Abs_score319
Specificity_index0.223
Rel_score0.421
T26F2.1 Chunk_score Abs_score136
Specificity_index0.095
Rel_score0.179
R10D12.15 Chunk_score Abs_score115
Specificity_index0.08
Rel_score0.152
C51E3.8 Chunk_score Abs_score102
Specificity_index0.071
Rel_score0.135
Overlaps_transcript C08B6.4b Source_evidenceePCR842WS150 Sequence/Annotation Release
C08B6.4a Source_evidenceePCR842WS150 Sequence/Annotation Release
WB_DNA_textsjj_C08B6.41014ctgcaggtgtatactgcggatgagaataagaaaagagacttggcggctttctttgcccacgctgttcaagaaactggagagaacaacattgctctatatgagtaagtgcattttttgctttattgtgtattgtaaactttgaaaataatcttttggtcaagttagaacctataggaaaaatcacatttccagcacactttccgatcaagatgcttcaaactgtttctaccgtggaggattttataactggtttgaaggaggaccaacaagtagctttttggatcctaaaactcctggttatactccagccgacggaaattcatgtgcatctgctggtctttattgttctgcttctgatcaaataacttatttctatccatgctcaaattcaacaatttcaaatactgctgctccatataaaggatgttattttggacgtggagccatacaaatttcgtacaactacaactacggacaattccaagattggttgagaactgtaaatattaaagttgatttattaaaagaaccaaatcttgtaatgactaaaatggatccaccacttgccgttctggcttctctttggttttatatgacacctcaaccacccaaacctgcaatgcatgatattgtaatgggaaactggaatagtggagcaaagaatgcagcagctggatatgatggaccgatctttgggccaacttcattgataatcaacaatgaatgttctggagaagatccaacaaatccaggaggtccaggagaatctagaagaatcaaggcattcaaatggttttgtggttactttgacactccaacaggaccggaggcgaccctctcttgtaaaagtaagttcagtttcatttttaaatgaataagaaattatatattatattaaaaaattatcgagttaacatttccagacatgcctgtaccactggatcaaattttctataatctgagttatcagcctgattggacatccacctggaaagatgttccatgcacttgtgc