Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C08B6.4_b   

sjj_C08B6.4_bSequenceGCACAAGTGCATGGAACATC
PCR_productsjj_C08B6.4