Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C08B6.4_f   

sjj_C08B6.4_fSequenceCTGCAGGTGTATACTGCGGA
PCR_productsjj_C08B6.4