Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08B6.9   

sjj_C08B6.9RNAiPF:GL1_4E4
PCR_productsjj_C08B6.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08B6.9 Source_evidenceePCR865WS150 Sequence/Annotation Release
Overlaps_Gene C08B6.7 Source_evidenceePCR53WS150 Sequence/Annotation Release
C08B6.9 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score Abs_score782
Max_abs_score782C08B6.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1013185010133039
Overlaps_transcript C08B6.7 Source_evidenceePCR53WS150 Sequence/Annotation Release
C08B6.9 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_C08B6.91190caaatcgatcgggttgaactggttgcatatcgatggtatgatttccagcggccacctcctcgttccagattggaattaatttctcaatatcgttttcagtgactccggtaagtttattttcgctggaagcgcggagcatacttttcacgaggaaatatgatgttggaacgatccgtttgcactttctcacaattttcttcgccgtgaaatcagagttgagcgtttcgacaaatgatggatatgaaaacgtttcaagcacgaattcttcatctaccgtaaccactgtgctcgtctttccggtttccgattcttcttcattcaagcaatccgggcttttagcttttctttaaaagaaatattgggatgagacttttaaaacgatttaacttacactaaataagcatggccatcgaaatcgaaaaatgcgtagccaatccatccgtagattgctccagaaataaatctgatgtggtgtttacggcagatattgttcacttttgcagtacgttcgtaactctcgtcgagaacaacaaccaacgtgaatttagtcaaatactcttcgatttccgaatcatttttcgatagaacatcttcctcgacgatgaaaagtttcacattgcggttcaaattataaagaaaattgtatgatgccgcccatttctgaaaacaacgttcataagatatgtataattcgaattaattacaaaccgtcatctttgaattatcaaccgaagcgtcgtagagaaaattcataccaatttcttctgtatcaacaagccgatgatcaactaaatgcatctcgtcaacaccagcgagtgacagagtttttgccacttccgcaccaagctgttttccaccaataatcaaaactttagagtttcggattctgaaaacgaaacaatagtattttattcgaaaaaatttaaacttacttattttgagcttccattccccataaacgaatttgtcgatcgtaaatcgcctgttcagctttgctgacctccatattttcttttgcttcggacattctgcaaattatggcaatcacaaaaaatatgaaaacatttagcaaaaatggttaatatgaacggcaaggtgaaccgaataaaatcgagaagaagtaaaataacgatatttaaataaatacacaattcattagaccagaaattaaacaacgagaatgaaacggg