Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08F8.1   

sjj_C08F8.1 RNAi JA:C08F8.1
Simmer:C08F8.1
PCR_productsjj_C08F8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08F8.1 Source_evidenceePCR354WS150 Sequence/Annotation Release
Overlaps_Gene C08F8.1 Source_evidenceePCR461WS150 Sequence/Annotation Release
Chunk_score Abs_score398
Max_abs_score398C08F8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1115000311150897
Overlaps_transcriptC08F8.1 Source_evidenceePCR461WS150 Sequence/Annotation Release
WB_DNA_textsjj_C08F8.1895ttctttgcttttctcgtgatttcttttaacgcaactcttttttgtctcaattattaaatcaactttcatattacaacttcagaaatggccgacgaggagatctcaaaagcgtttcgcgacttgcaattcaaaaccaatgaaacacgaatgcggatagttcaaggagaacaaaataagaaagttaactatcaggtgagtatttttgaatattaaatattgaaatttgatatactttaaatattatgagaaatgtatgacatcataacttgataacatagaaactagcgagtttcacctcttagcttgtgcctaagtcacaaatagtcacagctagtcacaactacaatctagctttgccaaaaaagtttttgctgtacatcggtattttttcattacacacatccattaaaaaacactcagcatttttaatatttaaaaacataaaagtataactttttctcttaagtaacgcttctaataactaaatttttcagaaaatgaggatctcagagagcacaaaaaagaacttggtggatttggatgaaaacctcaagtactatcgatctgttgggcgtatgttcctgctgaccgacaaaccagctgaaatttccagacatgaagctgaagctaaacagtcaaagtaatttcattcttccattcaaaacagtttacacaaccaatcccattttcagagagaaaattgaagctatcgagaagcagaaagactatttggagaaaggattggtggaggctgaaacgaatcttcgcgagctgattcaaagtagacgctgaaccctcgggaataatttctattttgtgtgtaaaattgctttattgtttacgtttgcatcattttttcgaatgaatctcttctggcgtacgtataaacgttttc