Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09B9.6   

sjj_C09B9.6RNAiJA:C09B9.6
PCR_productsjj_C09B9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09B9.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (30)
Overlaps_transcriptC09B9.6 Source_evidenceePCR425WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09B9.61014aggaacattagaacctgcaacaaaatcgatacaccaatgtaaaatgtttgaccgggcaaatcaaaaattgaattgttcatcttcagaaaaataaattacgggaaattcaaaaattgaattgtacagaatccttttcttcttcccacatattgtctttttttttaaatttcatcttctatcaataaactcgtcctggggttatcccgatctgaagccactgtgcactcttacagttgtactcaaatttgatacgtttttaaatctgaaatttttaaacaagagaaaaaacaacgatctttcaaaattcatttattgaataagaaagcacagggctctatgggttgtactcgattggaaggttcttacgacgaaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatccggggtgttggtccactcaacagtgatacggtcgttgttggtgtcttcttgtccaaaggcaaaagcatcacaggaaacggcaagaagaactgcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatacaatacggcgagccgatgagttgatcaccttgatgtggtaggtgtgtttgtcgtcgtatggggcattgaagacgatcttggtacccggctgggtttggatgtctcctggtgggacagattgggccatggcgacttgttgaaggagttatgagaactcgcagtgaagattatgacaaaaccttctcaatgtatagcacccttcttatctctgtcctagatctaaaagttcatccaaaaataggagatcacgtgaaaatataaaaatgttacattaatttttcaaatgaactgtcaaaacgcacatcgccctagttatgtatttgcgtgaaaaatccttgcagtcttttttcattcgagcgcgtttgcttttcatttatttttcaacgtaaaaatttatttacttggacttgtgagcagatttct