Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09D4.4   

sjj_C09D4.4RNAiJA:C09D4.4
PCR_productsjj_C09D4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C09D4.4a Source_evidenceePCR705WS150 Sequence/Annotation Release
C09D4.4b Source_evidenceePCR705WS150 Sequence/Annotation Release
C09D4.4c Source_evidenceePCR714WS150 Sequence/Annotation Release
Overlaps_Gene C09D4.4 Source_evidenceePCR714WS150 Sequence/Annotation Release
Chunk_score Abs_score588
Max_abs_score588C09D4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54832185484349
Overlaps_transcript C09D4.4c Source_evidenceePCR714WS150 Sequence/Annotation Release
C09D4.4a Source_evidenceePCR705WS150 Sequence/Annotation Release
C09D4.4b Source_evidenceePCR705WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09D4.41132cctcacgaaatactgcacgacgttgtttatcgaaaatgagaagcagttgttgattgagctctgaaaaaatcgattccgattccgttcaagtttaaaaaaaaagacaatttcggattaaattcttacaggaattacacaaaccttttgattttcgaaaaagaatcaacatttgttgatatattagggtaattttagtgctccattcgcatacatcggtctcaacacatcttgtcggatgatctgagctatcgaattgttgaagagccgctttcatctctgtttgtacatccagaacaactgtaaaataatgctttcgaattaattaacttttttttgtttcataccaactgaaaccgatgcattaatgagccgtgaattattgacgatgaactgttgaatagatcgagttgcgaataataaagcatgtgcagatgagttataaactcgtcggagttttgtgctttttgtagatgatgcctgtaataactgacgcaacagtttgatcagatttttaaacatcaagctattttttatatttattcaagcaaaattttaagatttgatcgttttccgtatttgagaactgctcaaaattcaaaaaacacaacgaaaaacctaggtgtttcttttttcaaaattttccaaaacattcaaattttttcgcaaaaagctcgaatattcttaccgattctgatgcatttgccttccgttgccgcgtggctaccataactaaactactaaaaacactcatagttatcgcagataggtaggtactgtcaaaatataaagaacgagcggcggcgacgagtcgtgttggatccagaggaatttcgacaattctttttgtgattttcacgaaggattcatattgtggaggatgataacggtccatgtatctatattaattcatgattttatgtttaatcaattgttggactgtcttacaataattcaatttcaatttctaatttttgaggctcacacaagttcaatgtcgaattgaattgcaccgaaatatggaaccaatcatctgaaagtaagataaaaaaaggtgtttcgatgattttattacctaaattgaatttttcatgttgataagttacttcaactgttttactgacagccgctcctt