Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09D4.5   

sjj_C09D4.5 RNAi JA:C09D4.5
Simmer:C09D4.5:Screen_A
Simmer:C09D4.5:Screen_B
PCR_productsjj_C09D4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C09D4.5 Source_evidenceePCR644WS150 Sequence/Annotation Release
Chunk_score Abs_score560
Max_abs_score560C09D4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54848235485810
Overlaps_transcript C09D4.5.1 Source_evidenceePCR644WS150 Sequence/Annotation Release
C09D4.5.3 Source_evidenceePCR627WS150 Sequence/Annotation Release
C09D4.5.2 Source_evidenceePCR637WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09D4.5988caacaaagttttactttccagcgataaccttctcgctctgggaaatttttctgagaagctcagcacgcttgacgacttgtctctcctcacggcgcttgcggctctccttgttcttgtcacgtctggcttgagcttggtcactgaaatcatcaggaattttaatatgaataattgattgaaagacttctcaataatttggaaaaacaaatcatttaaaaatagtaaaacttacgcaagttgcttggctctcttgttctcagtcttcttcttgaagatgtactcgatgagattcttcttgttcttgaagttgtttccctttgcgcgaaggtagagctcgtggtaaaggtgcttgtccaacttcttggcatctctgtatcttctcagaaggtttctgaggacacgcatgcgtcggatccagagggtcttttctggcatacgagcattggcagtaccacgacgctttccgtaaccggtgtgacgtccctaaattccaaatatttttttttaacttaaaatgtaacttttaaaaaatcgacagcatcaattaaaagaaaaatgtacctttctgcgggcctcctcgtactcgcgtgcgcggaagcgggagtggacagtgactggcttgcggatgataagtccgtcattgacgagtctgcggatgctttgacgggagttggctccagaaatctcgctgacctcattggggtcgagccagacacggtgctttccgcacttcaatacggccgaagccaaacgtttctgcagacggagattgctgaaaaatcaataattaaaaatgcaaattttgcacaattctcaattaaacgaaagtcatatcttcaaaagacgcttggactgatctttcaattggaaatgatttaaaaaactcacctcatttcgtcttgctacccagtatttggagtttcctgtaaaaaattaatataaagtacacaaataaagaaattttcacgaaaacaacaaaaattagcga