Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09D4.6   

sjj_C09D4.6RNAiJA:C09D4.6
PCR_productsjj_C09D4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09D4.6 Source_evidenceePCR609WS150 Sequence/Annotation Release
Overlaps_Gene C09D4.6 Source_evidenceePCR609WS150 Sequence/Annotation Release
Chunk_score Abs_score546
Max_abs_score546C09D4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54863195487314
Overlaps_transcriptC09D4.6 Source_evidenceePCR609WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09D4.6996ccgaatagcactattttgaggtgtgtttcaaaacattgtgaaaaattacgaaattttgaaacacaacaactttatttttcgatgctttattttattgtgaggaagtttctcaaaatttagaatgattaaggtacgagagttatcaatccatatgcaaattatccacatgatcaatccttggttcttctcccggatcatctggaccgaaaatttcccaatagtgtgccattaaaatgacatcaaacattattaaacaacttgatgctattgaataccagaaaaaatcaaggtgcgcctgtgataatatttcagactacagattgtgaggaaacctacgaaactgaaagagataccacatagcataactgttttgaaggctctatcgtacgaaggagaaattgctctattctgattccagtaaaatgggtccgccaccgagaaagttgggaatgttcctggaccaatgtttaaaagatacccgaaaaatgcaaaaagtagaaacgatacgatttgggtgatctgaaatagtaaaatctaggaaaaggattgaaatatcacgtacagtgctaggggcgatccatacaattccaacaattacaataatgacaattatcattgagaaatgtgttagaaccatttgcagagcaaaacttcttggacaaattacatttccaaacgttgatctcgcgattcgttcaatatgtaaaaacataaaaattgtgagaattaaactgaaagtatacgactccatcgtcgaaattccaatatttttgaaaactttaaatgacccgaatatcaagtacatatatccagtggcaaatgaaataataggcatcgtgtgaaatttttttgtagaattcagccagaagtgtcagaaatttttagaaaaaaagccaatacatcttgaaaccctaaaattagaaagacatacttatcgctccctctcaacgggcatcgggtagtcgtagagattcagaaagtgtccaaggagatgtc