Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C09H10.7_f   

sjj_C09H10.7_fSequenceTGTGGTGGACCTGATACGAA
PCR_productsjj_C09H10.7