Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09H6.2   

sjj_C09H6.2RNAiJA:C09H6.2
PCR_productsjj_C09H6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C09H6.2a Source_evidenceePCR752WS150 Sequence/Annotation Release
C09H6.2b Source_evidenceePCR752WS150 Sequence/Annotation Release
Overlaps_Gene C09H6.2 Source_evidenceePCR752WS150 Sequence/Annotation Release
Chunk_score Abs_score671
Max_abs_score671C09H6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI81143678115527
Overlaps_transcript C09H6.2a Source_evidenceePCR752WS150 Sequence/Annotation Release
C09H6.2b Source_evidenceePCR752WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09H6.21161gaagttctctgctcccgttgcattttctttagatatgaatcccttagcacccatactggatcatctgtaccagctgcagcgggaacactttgtgctccatttgttgtgctcgttgatgttccattttccttgttctcttcaggccatccatttccactcaccctccgtggaatcggatgagatggtggtggaggtggagccagtgctccggatggtccagaagatgttgatggcatcgaaggtggaggagaatcgaatggagttggagcagcggattgtgcaatttgttgttgagcaaacgcagcggctagttgctcaggagtaaattgttgcgcagagactgttggaaccaaaggtgcggtcccgttttgtacgaaattaggaagtgttgcctgagtttgaagaaatggatttgttccattgttcacaaatgttgctgaaaaattgttggttattcaagagctgacaatgattccagatcaattatgtttaaacctaggcacatttgtggaatcttgataaaaaggaaaactcacgattaggttgttgcatgaagagattatgttgatgtggttgcatcatctggaaaccaggggcggcgccaaatgtagcttgtggagtcatctgaaaattctgagatgcacggcctaggccaaaacggaatacaaatttcagcttaacctaaaaatatgactttaaaatcataccgtgactccaatcgggaatgcattctgcacaaaattccctgcattcgccataaacattgaattattcgcgaactgttgagactgttgaggtactgtagatggtccaactggtccaacagttgtcgaatcgtcgggaagattaaatgatgaacggagctgattgagagattctttcggagcacttttctccgtggaaggtggagctggagctgtgtaggatagaccactctgcaaatatgaaaatgttgagttgatttaatcatgggtaagccagaaacaagaatatagttcacaaagtcattgtttctgatttacccattcaaaattgaaatattcacagctcacaacaacatcaatagaatccttggattatggaaaatgactgttaatattgaaataaaacatttgaaaagttattaaaaaaagcacgaatgggtcgatttatgccgagaaa