Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09H6.3   

sjj_C09H6.3RNAiJA:C09H6.3
PCR_productsjj_C09H6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09H6.3 Source_evidenceePCR824WS150 Sequence/Annotation Release
Overlaps_Gene C09H6.3 Source_evidenceePCR824WS150 Sequence/Annotation Release
Chunk_score Abs_score740
Max_abs_score740C09H6.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI81260878127677
Overlaps_transcriptC09H6.3 Source_evidenceePCR824WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09H6.31591tgggcacattttacacgagagacaagatgaacgccatttcaatgcttgccgatcttcatattcattgtaatattcaaaagtttgtgtatattgttattcaaatatattattttcagaccaacaatggccattaacctctatcaaggcaacgattcgtcacgaaattacgacgacacgtggatttccagctttatccaacaaattgatgtttcaattaattgttagtgaagtttctcgaatttcctgcaaaaactagaaactattcaaaagcgaaaataatttaacagattttgagcgcctttcaaaaatcaaaaagaattaatgattcaaaattagtgtctaatgattattattcaggaattaatgaaaatcgataaagacgtcgaaggagccatcgaaatgtgtcaacttgcaatcaatagttcccatgctgatccaaaaatggaattatatttccgtattgcgaagactcttgtaacttatcaattaatgcacgaagaacctgacatttccgatgtaacgaggattggttcaatgattaaagtaatggagaacagtacaacatctgataaagcacatttggaatgtatcaaggatttctatgtatgtactaaactcgcgtacatgttctacgaaggaaaatctcgaacttcccggcaacttttacgacaaattcaaaaatcacaaacaagtggagagactaagatccatggcatcaggtatatgaactttgtaccgaataaaataattaaaaaaatgcttttaaaaaatttaaaaaacaattcgaatttttctttgaagcacaatttttgtataaacgaaaaaaaactttttaacttgcttttttttgcttttttcggaacgaaaatctcaaagaattttgtaaacttgaaacgttattttgaaaaacgataaaaatattatggtcaaaaaccctaaaaattgtgtttgaatcaatgaaaaacacggaaaaacgactctaatatgcaaaataaggtgatattcgagaaaaataactttattttcgtctactgtggcaaattttcagatttaagcagattttttttcgaaattttgaactgtcacgaaaattttaataaattttcagcatgaaattctcacatttgaattcattttatattcaagaaagattcaagaaagaagttaaactcctgaatataatggaatctagattttgtattaaattctcagttttcacatttttggcgtaaaatgtgaaaaattctaaaagctctcattttctccagaacaaaatttaaaattccatttcatttccagatggctcggcgaaccttcgataactttactggcatgtgtaatgaatcaaatctgtgctctcgttcaatcaaatacggatcgtgttgagaaatattatcatctcgtaatcaaacacgccgatgagattatattcaaatcaactcgatcaccacaagaacctggagttgttcgatgcattaatatgattaaaatgacaacattggaaatgatggcatgctgtaatgtattagcatgtagaccacaaaaaacattgcataatgttcgagatatgttggaatggtcaaatcgaaca