Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C10E2.6   

sjj_C10E2.6 RNAi JA:C10E2.6
Simmer:C10E2.6
PCR_productsjj_C10E2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C10E2.6 Source_evidenceePCR787WS150 Sequence/Annotation Release
Chunk_score Abs_score705
Max_abs_score705C10E2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1676892916770006
Overlaps_transcript C10E2.6.1 Source_evidenceePCR787WS150 Sequence/Annotation Release
C10E2.6.2 Source_evidenceePCR787WS150 Sequence/Annotation Release
WB_DNA_textsjj_C10E2.61078acttgtctggatcctcacggaactcggcgacattggagattgatccggtgtagaagacgtctttacggttgaggtatccactgtcacgctctccaactgttccgcgacgagatcttggctgagactcaacatcaacagctcccatggagctagctggccggatcttttcaccagctttttgaactccagaactctgagacattgatctctcgagcaaagatggcggactcaagagtgttgccttttctccgtgttcctcattagcagcagttttctttacatcctcgtccaatacctcatcattcacttcttcttcctcgtctggcaccaatgcaaactccaatggagcaaaagtggctccacacagagcacatagaaccaaaataaacaagaatgccaggaaaacactgcgccatccgtagttgttgatgaagaaagcgttgatcggggcgaaaaggacagttccaactccagcaccggcgactgcaattccagtggcaagggagcgcttgctgaaattttaaaattaactattttaaaaaattgttattctttgatttccaatgttttggaggacaaaaacaactattggaaatatgaatctgagtgaggtctcccggttgatcgcaaattagcgtttgcgatcgtagtgtcctaataatagttttaaaatcagaaatcaagataaaactaccaccaatatgaaaatcaattcatgcacttattggcgtcatttactctcaactcacttctcgaagtacatagtgacgatcacaatagccgggcaatacatcaatccaaagccggtacccatgatgacaccaacggtgatcacaatgtgccacatggcagttgcaaagtacgaaagggcgcatctgaaaagaaaccaacgttcctagaggcttcggatcattgccaattacccgacgaacgcaactcctgctccggtgattgtggtgatacgacatccatacttgttacacacggcagaagcgagcggtccacttccgagggtgagtccggtgagcagtgagatgatgagtgctgccattgtgttgcttgcgtgaaactcctgtga