Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C10G11.6   

sjj_C10G11.6RNAiJA:C10G11.6
PCR_productsjj_C10G11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC10G11.6 Source_evidenceePCR657WS150 Sequence/Annotation Release
Overlaps_Gene C10G11.6 Source_evidenceePCR657WS150 Sequence/Annotation Release
Chunk_score Abs_score552
Max_abs_score552C10G11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI62909276293168
Overlaps_transcriptC10G11.6 Source_evidenceePCR657WS150 Sequence/Annotation Release
WB_DNA_textsjj_C10G11.62242aaattattcgaagaaaagcggtctaaaatacaggaacaacttggtcgtgcatgtatgtgacatttattgaattttttttattaattcgaacatatttttagatccagctttggagaataaaataactaaagcattttatcgatcaagtcttccaattgtttcacctgatgttagacgtcctcctccatctttatcaattccgttgccaccaatgcatattccacctccatcagtttattttatttccactccatcaatttattctactgccaaatcatcaacttctacagttacatcgaaattgtcgaaggcaattgtaagttggatttcatattgattttaaacattaaaaaaatcgctaggaatagacgacaatagaaacattttgacattttccgaaatttaaatgctcaaaaaaagtcaatatttccggaaatccgaaaatccgacaattatcgagttttaaaattttcgcaaatgacatgtgaaaatgtgaatttagaaaaagttttaaaaattacacgataaacggatttctactgtagtagttgttttagtgaagaaataatgtaattttttcaaaactctctcaatcagggagtatttgaaaatcttccagaagttcgatgattcgacaagtgcccatattaaaaatattcggaaactgcttatattaagccttaaagcgccaaaattttttcgagttttaatttgagaaaaacatttaaaaaatttttttaaaaaaccccaaagtcattttttctcatacggaatttattttttacgttataatttacacttttttaaaagcaaatgagaccccaaaatgttttttaaaccaataaaccgaaaaacaaaaaacttttagtaaaattcagaacatatttccttgtttttcgttttaatttaaattcgatttcagataactccaacacctccacaacctctgagttctccacatttattgccaccccgaactagtgattatagaaaaacgtatgccggcaacttcaaaaggtcagatacttcaaaagaaggaaagcatgtgtttgatgcaacgaagtttaaagcaatgggtatgcatgcacactttatgttttttttcaaaaattaaattcttattaaattctttacccattttttcaaaatcttgcatgataatttttactgaatagaggaaaactattgctttctaattttacagaaaaattgttttctatatttgagtgttcttgtctaatctgtgtttctttgcatgatttccataatttcaagaaacatgtgaaaatgcaatttgtatcatcacaacaataatttcagttccacgagataacacatcatggcgtactccattccatccaactcctgttcctcctccatcaatccatacattcctcaaaggatgtcttccgtctccgtttgttcgaaaaattcccgagatcacacctcggcggcattcaacaggaacagaaaacaggtattttttaaaaattgttttagatttgaaagtaattttttcttttaaaaaattgtattctagtttagctctcgattatcctgtttctttttttactctgatgtatgaatttgagtagtttaccgtagatcctccatgcaaaaattttgaactacagtactcattgaagattcacgttatcgacgagcccccggtctcggcacgacaactctttgtgaaatacaaaatagtgagtattttaaaatagagtactgtagatgctgattcttcgattttgaccgtactttcttcgtttttcctaaattttcactgaaaaacgtacgaaagcatatcaaaataatcatagtttgaagaaacatgaaaaataattagaaacattaaaaattaaaggcgcaaggcgcacattttggcaaagtactgttcggctctcttctattaaagtttcatatttaaattaaagacgttaatgtttttatttgtttcaaaaatcgatcgattactcacacagttatttatttgttactgaaaagaaaacatctttgttcataagacaaagattcgttatcatctatttgtcaattagtattatattgatctaatcacatgaacaaagtatattcaacaataatagttccattttagaattgtcaaattatccttctactaaccgttgtttaaaaactttctaaactgcgtgtaggctacaatcgatatttgttttaaaaaagcaaagtttaaattcttcacattcactctcacagcact